Description :
From Genome Similarity Track
Location :
Scaffold_107:3734- 5340
Sequence
1606 bases(100 bases per row)
CTGCTGGGAGAACAGGGCGACCTCGAGGTCGCAGCCTGGGCCAGGAGCCACGGATACCGCGTCAGTGTGAGCGGCGCGGCCAAGTGTGGCCACCTGGAGC
TCGTCACGTACCTGCACGACGCCGGTGATCCGTACTTCTCAGTGACCACCATGGACGCAGCGGCGACGAACGGCCACCTGAACATTGTCGCGTTCCTGCA
TGAGCACCGAAGCGAAGGGTGCACGCACGTGGCACTGGAGGGCGCAGCGAAGAACGGGCATCTCGAGTTGCTCAAGTTCCTCTGTGATCATCGCGATGAA
GGCTGTGTCGCTGACGCAGTCCGTCTCGCAGTCATCAGCGGCCACGTCAAGTGCGTCAAGTACCTCTTCAAAGCCAAGGCGAACGATGTACCGAGAGCGG
AGCTCGTCAACAGCGCTGCGAGTCGAGGCCACTTCGAGTGTATCCGATACTTTCACGAGAATGACCATCACTTCCAGTTTACGCCCAGTGCGATGCACTC
CGCTGCGATTGGGAACCATCTTCTGATCGTCAAGTTCCTCCATGAGAACCGAAGCGAGGGCTGCAGAGTGAACACGCTCTTCGAATGCGATAAGAAGGGG
CTTCCTCAAGTGGTCGACTTCCTCTGTTCGCATCGCCCCATGGCGAATGCAACTCAGGTTGTCGCGAGAGCCAAGAGAGAAGGACGAGTCCTGCTGGCAG
CGAAGCTGGAGCGTGGGGCTCGCACAACGAAGCCCACGTATGTCTACAAGTAATTATTGTGTATATGGCTCAGTGTTCTCGCTTTCTGTGTATGATCTTC
AGCTGTACACAGTAGATAGCGGGCAATCTATCGGATATTCATGAAAGCTGAAGTACTGTAGCTTTTCCAACAGAGCCTTCAAACTCGAGATCGTCACCCT
CAGCAGCCGCAACTTTGTCTGTACTGACCGTGAATGGCGATTTCGAGACGAAGAGCTCCTGAGGAAACTCACCATCCAGGTACGAGCAAACGGGAGCAAA
GCCCACGTCGTCAACGCACACGACGAACTCTGGGCGGTCGTCAGCATCCAACTCGCACGCGAAAAAGCTAGTCGCTGGTAGGATCTTGGCTCTGGAGGTC
GCCTCACTGGTCCACTGATCCGCGTCTCGGTGTCTAAAGTCGATTTTCGCTAGGCTCTTGGACTGGTTCGCACTGCTAAGATACTCGATGGTCGCATTCA
GCGCCCGAATGTGCTGCTGGAGCTGGTCGTTCTCGATCTCCAGGAACACCACGTTCCCGCGAGCCTTGAGCAGTTCTGCCTGCACACAACCAAGCTCAGC
ACTGCCCTGATACGACGCCCACTGCTGCGCCTCGTACTTAAGGCGGAACGCGTCGAGATCCAGATCGCAGTCGTGTTTGCTGGCCTGCTCACACTGCAAG
AGATGCTCCAGTCGCTCTATCTCGCTCTGCGCTGTCAACTGGTACGCTTCGAAGCTGGCCTTGAGCGCTTGCATTTCGGCCTTGAGCGTGTCGCGCTGGG
TTCGCTCGCTCGATAGCTGGCGCTGGAGGTGTGCTATGCTATCTTCCAGTTCGCACTCAATCGCAGTCGACACGTTGATCATCTCTTGGAACTGGCTGGC
GGCTCT