Description :
From Genome Similarity Track
Location :
Scaffold_37:37327- 42533
Transcript NameFunction/comments
Phypl_g1452hypothetical protein

Sequence
5206 bases(100 bases per row)
TGAGCAAGCCCAACCGGTGGACTCGGAGCAAAAATGTCCACTTTAGTACGTGCAAACACTCGAGAGCTTTGTACGCTAGTTCCAGCGGAATTCCACGCGC
AGACACTATATCCATAAACTGTGTTCTTGGTCAGCGATCCGCGCCTAAACGTGGTGCTTGTTCCGTTGTATAGGACATCACCAGTGGTGTCCGCATACAA
TATATACGCGACAACCGAgtcgcctccagcgtcttcgctACTGGTCCATTGTATGGTTTGAGTCCCGGATGTAATTAATACCACAGATAAACCGCGAGGT
GTGTCTGGCAAAGAGACGAGTGTATCGGTGCTGCTATACAGAATTGTGCGCTTGAGTACATCCGAAGGGTTCTCACAAACACTCGCGTCATTGACCCCCG
AGACGGAAAATCCGTACGTGGAATTTGCCAGTAGCCCCACCACTTTTCCCGTGACTGACGTCGCACTCACGCTGATGCCTGATATCCTTTGTCTGGATTG
AGGTTTGACTTCGTACAATAAGAAAAAATCTACGTCGAACGCCGTAATGTCAGCTCCACCAAAATCCACAGGCGATGTCCAGGTAAGGGTCACCGATCCT
CCAGTTCGAGACACTGCAACCAGGTTTTGCGCTTCGTCTGGATGTGACAAGAATTCTGTGGCCGCAACAAACACGTCACTCAATTCACTTGCACCCTAGA
AGAAGCAAGTAACAATGTCAGTTAGATTTTAAAATTCATCAGGAGATATGTAGCGCAATGAGCGACGCACCACTTTGTTGGTCACCTTGAATTGCATCTT
GTACGTTGTAGAAAAAGTTAGTCGCGTCGCGTAGAACGACGACGTGTCGCCTTGATATACTTGACGGAAGGCATTGGGGTATTGCGCGGATGTCATGAAC
AACGTAAAATTCAAGATGGGGGCACCCCCAATATCCAGCGGAGGtgccatctccacgagcaATGCACCGCCCGTCGCCTTTGTAATCACCAGAGACGTAG
GTTTGCCTGGTAGAGAAGCTTCCGTGGTAATGAACAAGACCGCAGTACTCACTTCTCCGACCAGGTCATTTTTGTTGATGGCTTCAACTGTCGTGCTGTA
GCTAGTAACTGGGTCAAGCTTGCCGATCGCTATGGAAGTCACACTTGTTGTGGATGTTCCTAACAGTTTGTTGTCAAAGCTGGTGCTTACATTCACCCGA
TAGCTGCCAATATCAACACCGCCTGCGTCAAATGGAGCCGACCACGATAATGTCACCATTCCTCCCGTTTGCGATAGGACCTGAACGCTGAGGGGGATTG
ACGGGTGTGTTGACTCTTTCATTAGGATAGCCAGCGGCGATGCATATTCACCTTGGTAGTAGTCATTCCTTGTTGCGATTGAGATTTCATACGCGGATCG
AGATTTTAGCTGAGCAATTAGCGAGCTGGGTGCAGTGACAGATAATTCTCGCGTAGACCCACTTTGAACTTCCACCACACGAGCGAAATACAGCAAAGGT
CCAGGCTTTTTCGCTCCTAGGTATTCTGGAGCTACCCACGAAACGTTAATCAGTCCTCCCGACACTGCATCAACTTGAATATTGGTGGGTAAACCCGGTG
GTGACGTATCTCCATCATCCACGATTTCGATCGTGGTGGAAGCTGTAGAGTCAGCAATAGCAATTCGCCCCCTTGTTACGTTCATCGTTAACTTGAAGCT
CTTTTGGACCTGATAGGTTGAGTCATTAATAATTGTGACACGGAATGATgcctgcttctgctggtcGTCAAATGCAACCGATTTGGTTGGAATAGTGTAG
TCGACACCTTCGACCGCACCTTCAGGGATGTCAACTGTTTGAATTGTCACGGTACCATCACCGCTGAATTTGTTTGATCTCGTGATCGTCACCGAAAGCG
TTGGCTCGGATTCGGAAACACTGTAGTGCTCCTGTCCAAAGTCCAAcacgccagcgtctccgtcgtcaGTGATGGTAACTTTCACCGTCGAGATGTCTCC
AATAGCACCAGATTCGTCATTCTCACCCTGGATTGAAACAGAGAAGAACTTGTCGGGGTCATCGATCACATCGTTGTTGATAATGTAGATTGTTATCTGC
TGGGAATTCGTAGTCCGCTCGAATTCGATTCGGCCACTGGACTGGACGTACTGCTCACCGGCAATTGCTGTTCCATCTTCGGTAGTGAACCTACAGGTTG
CTGGCATCAAGCCACCCAAGGTACGAAGGAGCGTAAGAGTGACGGATCCACCATCTTCAGAAACGTCAACCTCGCTTTTGGCAAAGTTAATGACTCCAGG
TGATACAGGGTCCGTCGTCACAGAAACAATGGTAGACCATGGTCCCTCGCCAATTAAATTATATGCACGAACTTGAATGGGGTAAAGTGTAGCAGGCTCC
AGGCCCGAGAATATCAAACGATTCGTAGTGCTCGATATCATCTTGCTATCAGCAGCGCTTGAGTGGATCTCAGCCTCATACTGCACTGCTGTTACGTCTC
CTCCCGTATCGTGCGGCATCTCCCACTCCACCTCAATTACTTCATTCGTCTTCGAGATCATTGTTAACCCCCAAATTTGGCCAGGTGCCGTAATCGAGTC
TGTCCTAACAATCAGCGCAGCACTCTGATCGCTTTCTCCAACAGCGTTTATCCCTGATACGGCGACTGAGTAAAATGTGAGTGCAGTTAATCCCACAAGG
TCGTACTCCATCTTCGAGTTCCTTATCACATCACCTAGAGTTCCATTTACGTAAAAGAAATAGTCGACGACCTCAGTCCCGCCGAAGTTAGAAGGTGGCG
TAACTTCAAATCGTAGACTGCCTCCAGTCACGCTTTCCAGCCTCGGAGCGGGCATTTTATCCGGAATTGTAGCGGCCGTTGTCGTGGTGGTCAACGTAAT
GGCCTCACCGTTCCCCTTCGCGTTCACTGTTTGAATAAGAACAGAATACTGTACATCCGCATAAAGGCCTGTGGTTATGAAGACCGAGTCCGTCGTATTG
TACGAATCCACAGTCACTGACCCACGCTTTACGGTTAACTCATAGCGAAGGAATGGAATGCCACCCGTGTCTGGTGCTGGTATCAGTTCCAGCTTGATAA
ATCCACTGCCAGCTTCGATCGCAGTCGTGGGGGCTCCAGGTACAGAGGCAGCGGCACTATGAGCGGTGATGACAGCTGCGACTGTCCCCGTGACAATGTC
ATTTGAAGCAAACACCGAGTAGCTATAGTCCTTGTCCGCGAGGATATTGTTTTCATCTTGAAACGTTGTTGTCCCACCGAGAGCTAGCACCTCATCTACC
ACGATATTGTCGCGAAGAATGTTGTACTGCTGTACTTTCGCCCCTCCTGAGTCACCAGGTGACTCCCATGCTAGTACGATAGTTCCGCCGGAAGCGGCCT
GAATTTGACGTAAGGACTTTGGAGGCCCTGGGGCACTGACAGGGTTCGTCGTCACATTCAGAGACGGCGAGTATAATCCAGAACCACGCGAGTTTTCTCC
GGCAATGGCAAATTCGTACCACGAAGACGCGATGAAGCCATACAGCGTGAGGGAAGTTGAGCTAGTTGCGCTAACATTTGCCATTGATTCGAGCTGGCTG
CCTTTGATCCCACCTTTGATAAGGTACCGAAGCAAGGCTTCACCTCCTGACGATCGAGGAGGGTCCCATGCCAAAGTCACAGAACCACCAGTCACTTGAA
GTGCACGGAGGTTTTTCGGCTGTGACGGCGCAGAAGCATCTCGCGTCTTGATTCGAAGCTCATCACTTGGTGAAATGTCTTCGTCAGGGCGGCACAAAGT
TCGAAAGTTATACCCAGTGACACTAAAGGCGTACTCGGTATTGGGCAGTATGTTCGTGATCAAGGCCGTCCGTGTCGCTGATTTTCGGGCGTCGTACACA
ACTTCCGTGAGCGACCAAGAACCATTTCCATCCTGGTGGCGTGACTGGATCCTGTACCCCACTATACTGAGCCCGCCAGAGTCTAACGGAGTACCCCACT
CTAGTGTCAGCTCGCCTGGATCCTCAAGAGCTACCGTTGGTGCTGCCAATCCGTTCACCGGTGTTGGCCCAATAGTGGAGTAGATACTTTCTTCActtgt
ccagctccaacCCTAAAACAAAAAAAACAAAGTGTTAGTTTACAAACGTTTGCATTTACAGTAACTACAGTCAGTACCTGCATATTTTCCACGGAGACCG
TAACAAAGTACTCGGAATTTGAAAGCAGGCCGTAAATGGAGATGTTGGCGATGTGACTGTCGTAGGGAGGGCTTTGGACCGCTCCAAACGCATATTGACG
GTAGGATAGAACACTCCCGGTGTGTTGGGCAATGTTGAGGGTGTAAAACCTTAACACGGATCCGCCGCAGTCAGCGGGAGCCAGCACGCGGACATGGAAA
GCTCCACCAGTAGCATAAATCAATTcgggaggaggaggttgcTTCGGTGACTCGGCACTACCAGTCACTGCACTGACATTGGAATCTGGCCCGACCAATC
CACCGCCATTCACGGCATAAATCGTGAAAAGGTACCTATTAGCAGCAGCTAGGAAACTGGTCGACAGGTTCCGCTCTGAGCCATACACTTCGATGAGCCG
TTCTTCATTCGTAGCTTGGTTCAGGACTGTGACCTTGTACGTCTCTAGTGgccttcctcctcgatcAATCGGAGCTTCCCACGATAGGTTCGCGTACCCA
CTAGTAAGCGTACCAATGATGAATTGATTGACTTGAGTTGGAGCTGAAAGTACTCCAGTGAAAATACTGAGGTTCCGGGTTTCGCCTACTCCATAGCCAT
TGTGAACCGCAGCGGTTGCCACATAGGTCGAGTTGTAGTCTAGATCGCAGATACTGATACTGTTGGTGACGGTAGTGTACGAtgcggagaagctggtgct
tgACCGCGACACAGTGACGATGTACTGAAACAACGCCAAAGTGTTTCCACCCATAAACTTTGGTGGCTGTAGACCCAATTCGATACACCCACCCGTGCTC
GATCCTTGTGTAAGTTGGGGCCGTCCTGGCAGACTCATGTCCCCTCTGTCCTGAACAACCACTGTCAGATTGCTACCAGTCGTAGTAGCTCCATTTGTAG
GATTGGAAAGCATGACCACAAACCGCCTCGTTTCATACGCGTCGCAATTTCGAATACCAAGCGACACAGTAGCGCTCCCAATGCCATCTTCAAAGTTCAC
GACTTC