Description :
From Genome Similarity Track
Location :
Scaffold_81:37325- 42689
Transcript NameFunction/comments
Hyaar_Emoy2808455hypothetical protein
Hyaar_Emoy2808456hypothetical protein

Sequence
5364 bases(100 bases per row)
CCAGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGATTTTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTCAAATCGAATGGGACACTGTCGAACGCTTGAGTTCAACGATAGGGCAAGTAGCCGTTGGCACACTGCTGTCCGCCCTGGGGCCAGACGGACAG
CACGCCACCATCGCCAACTTCATTCAGAATGAACTTGACGTCGAGCGGGAAAAAGTAACCTTGCTTCACCAACAAGGTTCTCAACAGACAGAGCTGTTGA
GAGAACATAGTGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGGCCACTGCTACCGGGTCGACGTATACACGTCAACCCGAGACTCTAAAGATTGACAT
CTCAAAGTACAAGGGAGCCGGTGAAGACTCCCTATTGAGATTGTTCGTGGAACTAGACGATGCCATAAAGGCTCGTCATATCGTCGATGAGGAAATGCAG
ATCGCATTTGCTCAATCGAACTTGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTCCACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCA
AGTCCCTGCTGAGGCAAACTTTTGAGCCTCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAGGATTAAGCAAGGTAAACGTGACGTACACTCGTA
CATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCAACAAAAGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAACC
TACCTTTTCCGATTGGAGTTCAACACCCTCGAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAATTCGAATTCCT
ATCGTCCATCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTAACACGAGGAGCGAGAGCTCTCGTGATAACAACTATAAGAAATTGCA
GAAATGCAATAGATGTCAGAAGACAGGGCATTACGCATATGAATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGGAACAGTAACCGCCAAGCGGCC
AAGAGAGGTCCAAGGCGTGAGTCCGACGTTGTTTCGAAAACGCAACAACGTAACGGACAGCCAAAAAACGGTCAGGGTTAGTAGGTGCGGAGCAACCTAC
TGATCCAGCAACGTCAAGTGAGTTTGCAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCCTC
ATTACCTTGAAACTCGAAGTGACACAGAACATGTCGCTTCTAGCCCTAGTCGAGCGTGGGGCGTCGAACAACTTTGTACGACGCCAATCGCTAGACAACA
GAGAGCTCGAATATATCGAGCGCAAGATCCCTCCAACGAGGATGACGGCGCGCCTCGCGCAGGCGCATCCGTAACAGTGATGAAACGTGTAGTGGGTATT
ACCTATACACTGAAAGAAGTCCAATAAGATGATGACTTCATCGTCTTGGACTTGTATGACAAATTTGATGTTATCCTTGGACTGCCGTGGCTCAGAAGGT
ACGATCCACAAGTCAGCTGGCATCGACGAACAGTCGATGTGCCTGTCACTTGTTCATCATATGGCCATCTGATGAACGCCATGGAGCACCCACTAACATG
TGGGTGTAATACGAGCGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGACTGATCACCACACCATGAAGCCA
GATTCCGGCGACTGCAATGAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGAGTGTCCTCCAAACGGTCACATCC
CAAGTGACAACGAACCGATTGCCGATGATTGGCAATACGGTGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTGGCCACGGTAGCGCAACCACC
GCCAGAGGACAGCGAGGGAGCAATTCCACTCGTGTCATATGATGATATAGCCCAAGAGGATAGTGAGGGAATAAGTCCCCAGCCAACTGTGGAAATAAGT
TCCCAGGAGACAACAGACATTAAATGTCCTGGTCAATGACGGATCAAGTATAGGCACTTACAAACTTGATCTGATCGCGCCTCCGAAGACAACTTCGGAG
ATCACTCAATTGCACACGCTCGAACAGAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAGTACG
TAACCGATATTCGGTCGGCAATGCTATTCGCTGAGAACGAAAGGGTTCTCATCAGCTCATCAATCGACGAGAGTTCCCTTGATATGAAGACTCGGATTGA
GCGATATGCATCCCAATCGTGGGTATCGCTCAAGACAAATTCTCTCTACGATAATTTGACAGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTGCGAG
CTACCCAAGGATAAGGGTACTCGTCACGAGATCTACCTGAAACCAGTTCAAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACTAGC
GATTGACAAATTCTTTGCCGATCGCTAGGCAGCGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAGGCCACATGA
GGATGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGGCTA
CGAGTACCATATTTTCATCGATGGATCTGATGGACGGGTTCTATCATATCCTTATGCGTGAAAGGGACATTCCTTATACATCAGTGAGCACCCCAAGCGG
TATTCTTTGGGAGTGGTTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAACAGACGCGTTACGAATCTGTTGAGATCTATGCGAGAATTT
GAACCTAGGTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGACGGATTTGGAAGTCCACCGACTCCACGTCCGAAAGGTTCTTACAC
TGATGCGCGAGCATAAGTTGCCAACCTCAAGAAGTGCATATTTGCTGCAAGCGAAATACTAATTCTTGGATTTATCGTGGGTAAGCACGGCGTCCGGCCC
GATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTAGTCTAGCGGCGTATTTGCACAAATACT
CGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTCTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTACCAGCGCTCTTTCGAAGGTAT
CAAGCAAAGCTTGATATGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTGCCATCGGATGTGCA
CTAATGCAGTATGACACAGACGGTTCTGAGCGTGTCGTCTGCTATCAGTCATGTCACCTGCACCCGGCTGAACGTAACTACCCAGTCTATGACAAGGAAC
ACCTTGCCTCGAAGTACGCTTTGGCGAAATTTAGGGTCTACCTGCTAGGTGATAGACCCTTCATCGTTTACACAGACCATGCGTCCTTACGCACGGCTGT
TAACAGTTCACACCTCTCGCAGCGAATGGCGAGGTGGTCGTTCTTCGCGGAGTATAACGTCTCCGTGGAATATGAGCCAGGACGACTGAATGTCGTCGCT
GATGCTCTGTCGCACCGGCCCGATTTCGAATCGGCTGCGCAACCCGACACTGGTCCGACCACTGTTGCAGTGTTGACGTCGAGTGTCCCGTCGTCAACCT
TATTCGAAGACATACGAAAGGCGTACGATCCGGCGATGGTGCGTTTGATGCATCATCTCTTGCAACCATCCCGTCAATCCCTAAAAGGGTTGCCCCCAGT
ATATCGATCTTCCACGGATCGATATACAGTCCACAATGGCTTACTGAAGTATTCAGCTGTTTCCGGCGACACGCCTCGTGTCGTCGTACCGGACCATGGT
GACCTGCGACTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGGCATCGTGGTCGAGAGAAGATATATCTCACAGTTAGTCGCGACTTTTACT
GGCCTCGCCAGTATCATTTCGTGCGTAAGTACGTCCGCGCATGCGAAGTATGTCAACGGGTGAAGTCTAGTCCTTCACTTCGTGCGCCGTTGCAACCCTT
GCTCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGGATTCCTCGTAGACCCACACAAGAATACAGGTATTCTTTTGTTCGTTGAT
AGATTCAGTAAAATGGCACACCTCGTCGCTGTACCTGAATCTATCAATGCATCGGCATGTGCTCGTATTTTTATTGACACGATCTTTCGTCCTTATGGGT
TGCCTCGTGAACTCGTCTCCAATCGAGATCCACGGTTCACTGCTAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCT
GACCACCCTGAAACAGATGGTCGTCAGAATGTGCCAACCGCGTTTATGAGGAAATCCTTCGGGCTTACGTCCATTCGTTACTAATTGGAGCGAATTCTTG
CCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATTGACGGCGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCTACCCACCATTT
TAGAGTGTAACTCTAGTTTGAGAGGGGGGGATCATTCGAGCGAACGCCAACTCGGCTCTCACTCATCGCATACTGACCACGAGGTCACTACGTATGACGC
CGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGGTGCTCTTACTACCCAGGTCACTGATCTTGCCGCAGTGCGCTCCAAGCGC
AATATAGCCTAAGACAGCGAGTCAGCAGATGGATTCATACTGGCTCGCGAAACGGTTGTCTGTTTCGTGCAAGATTCCATTGCAGAAGTGGTGGACCGAC
CACAGAAAAAAGCTGACTAGAATGGAAGATCAAACGTTCTTTCATTCAATGAAGGTGACCTAGGTCTACTACTACGGTAAACCTACCTTGACTCATAGTG
ACTAACGTGGGAAGTAACAAGTTACTACCCAAGTTCATCGGTCCATGTCGTGTGCTGCGCCACTTAGGCAACGCATACACGATTGAACTGACACGTAAGA
TGCGCACGCATCCTACGTTCTACGTCGGTCGTCTTGGGCCTTATCACCAGTACGGGACTTCTAC