Description :
From Genome Similarity Track
Location :
Scaffold_111:37315- 38877
Transcript NameFunction/comments
g7407.t1hypothetical protein

Sequence
1562 bases(100 bases per row)
CCTCGTGGCGCTACCGCATCTGCACGAGGCCTCGATACTCAACGCGCTGCGGCTGCGCTACGAGCGCCACGCCATCTACACGCACATCGGCGAGATCCTG
ATCTCCATCAACCCCTTCCAAAACCTCCCACAGCTCTACGGAGACCAGGTGTTGCAGCGCTACGCCTACGATCACATTGCGCAGTACGGCGACCAGGTGA
CCACCACGGACCCGAGAGAGCCGCACCTGTTCGCCGTGGCGCGAGCAGCCTACATGGACATTGTGCAGAACTCACGCAGCCAGTCCATCCTCATCAGCGG
AGAGAGCGGTGCCGGCAAGACCGAGGCCACCAAGATCATCATGACCTACTTCGCCGTCACGTGCGGCACCGGCAACAACAACCTGGCAGCTTCAACTTCA
ACACATGAGACAGAGCAATCCCCGCCAGCGTCACCTTCACGCACCACGATCGAAGAGCAAGTGCTGCAGTCCAACCCGATCCTGGAGGCTTTTGGTAACG
CGCGCACAGTGCGCAACGACAATAGCTCGCGCTTCGGTAAATTCATCGAGCTGCGCTTCCGCGACCAGCGACGGAGACTCGCGGGTGCGCGCATCCGAAC
GTATCTGCTGGAGAAGATCCGCGTCATTAAGCAGGCTCCCCATGAGCGCAACTTTCACATTTTCTATGAACTGCTGAGTGCAGACACGAAGTGCGTGAGT
AAGGAGCAGCGCCAATCTCTGGCGCTGGGTGGTGGCCCTCAAAGCTTCCGTCTGCTAAACCAGAGCTTGTGCTCAAAGCGACGCGACGGTGTCAAGGATG
CTGTGCAGTTCCGCGCTACTCGGAGAGCCATGCAGCAGCTTGGTATGAACGAGTGCGAGATCGGCGGCGTGCTGGAAATTGTGGCAGCAGTGCTGCACAT
GGGCAACGTGGACTTTGAGCAAGTCCCGCACAAGCGGGAGGATAGTGTGTTCGCTGATGAGGCACGTGTGGCGACGTCGACTACTGGGCCGTGCAACCAC
TTTACAAAGGCTGCAGAACTCCTAGGAGTGTCTACAGAAGCGTTGGGCCACGCACTAACGAAGCGTTGGCTTCACGCTTCCAACGAGACGCTAGTTGTGG
GCGTAGATGTCGCTCACGCACGCAACACTCGCAATGCGCTAACCATGGAGTGCTACCGACTCCTCTTTGAGTGGCTTGTAGCCCGTGTCAACAACAAACT
TCAGCGACAGGCTAGTGCACCATGGGATGACGACGAGAATGACGATGACGAGGAAGACGCGACTGATTTCATCGGACTGCTGGATATCTTTGGGTTCGAG
GACATGGCCGAAAACTCCTTTGAGCAACTCTGTATCAACTATGCCAACGAGGCTCTACAACATCAATTTAACCAGTACATTTTTGAAGAGGAACAGCGAT
TGTACCGCGATGAAGGCATCCGCTGGAGCTTTGTGGATTTTCCGAATAACCGTGCATGTCTCGAGCTGTTTGAGCACCGCCCCATTGGCATCTTCTCGCT
TACGGATCAGGAGTGTGTCTTCCCTCAGGGCACAGATCGTGCTCTCGTTGCAAAGTATTACC