Description :
From Genome Similarity Track
Location :
Scaffold_172:37311- 55325
Transcript NameFunction/comments
g6223.t1hypothetical protein

Sequence
18014 bases(100 bases per row)
CCGCAAGTCGACAAGTTGGTCGTATTGGTTTCGTAGCCGATCAGCTCAGGACTCTGATAGCCGAATGCGATTGATTTGTTCGCAAGCTGAAGCCCTGATA
CAGTCATATTGACAATACGTGAGATGCCTTGTCCTGGTGGCAAGTTGAATTTGATGTTTGAATGGCTGAAGTACACGATGTCATCGCTCGTAATATTCAC
CGATTCCATCACGCTATCGGTGCTGGCCAGCTCGAGGTGCCAATCAAACGTCTGGACACCAAAGTTTTTGCCGGCAAGTGTGATAGCTACTCTCTCGCAC
AGCTCCGTTTCTGCAGGACAGGCACGTGAGGCTGCCTTTGAGCAAGTGCCCGGGTTGACTTTCATAGCCACCGCACTAACGGGTGGATCCACCATCACAT
TGAGCCAACCTGCAGGTGTTGGGTTCACTGTCGCGGTACTAGCACGATAAATACGTTCATCACTTTGTAACAATTGCCAAACCCCACCGGTGAATAGCAG
CTGTACATTTGTCGCTACATCACTCATGTACACTGGCTTGTTGCTGGAGTACACATCTGCCTCTGCAGTGACTGTTACTTTTTGCAACACCCCATTTAGC
AGTGTTTCCACGCAATAGCTACCAAGCTCGGTGGTAGTTGAGCTTGCTTCGAGGAAATTGCACTCAAACGGTGCCAAAAGCGTTGCGCAGGGACGGTCTG
GATCAGTGCAGCTGCAGGAATACCCAGAGGTCGGGCCATTGCTTTTACTAATGCTGTAGACGAGCGGGGGGTCATAGCTGAAAGTCACATTCTTGTCAGC
ATTAACTTGACCACTGACAGTGACTACGATTGTATGGCCACTTCCTTGGCCCTCGCTTGTCATGCAAGTAATCACTGCATGCTTAACACTGTTGATTGTG
CATGAAAAAATATCACCAATTAAAACGGTATGAGCGCCTGATAGCTCGCTTGTCCCGAAATTCTCGCCTTGGATCGTCATCAAGGAACCACCTTCGGTGG
TAGCGTCAACCACTTCGACATTATAAATCACAGGGGCGTTGTAGGAAAACACCGTTGCAGTTTCTTGGTTCCCCGCGGTCAACTTTATTGTGTAGTTCTG
CCCTTCCCCAGGAGGAATAGTGACTGTAGCACGCGAGTGATCATACGACGTGATTTCAAGTGAAACAGTTCTGTTGGAATTCCCAGTCATCGAAATGACT
GGCGTGGTACCGAAGTTTGATCCAACGAGAGAAACAACCTTTCCGGTTGTAGAAGCAGAAGTGGCAGAGCTTCCGTCCCAATCCACGTTTGGCGGAATAT
AACTCAAATACCGTGGACTACTTAGAGTTATACCTCGTGTTACAAGAAGTGGAAGCATGACGCCTTGACCGCTCGGCATTGTGCACGAAATCAGGCGGAT
ATTGCTCACCCCTGTGACCCCCCCAGACAGAAGTATGCTGGAAGGGATGACCGGAGTGCTCACCGCGACATTGGTACAATTGTTTCCACCCACTGTTACC
CGGGGACTACGGCCAACATACTTCGCGTATAGACTTAGTGTAGCTCCACCACTAGTTGCTGATTGGTAGCTAAACACCCCCGACATAACGGGAGTAGTTG
CTACTGTTCGGAATAAGCTCGTGTTGCCATCCAATCGGTGACTCGTTGTACAATCCAGTACCCCGCAGGTCGAGCTAAGTGTGTACCAGTCGAGAATGGA
CGGATCATCCCAGCTGAACGGCGCAGAATTACTCAGCAGCTTCTCTCTGCCAATCACAATGGTCACGTATCCTAGACGGCCTACGTACTGCGGGATTATG
ATGGTGTTATGAGACCAAGACAAAACCTCAACTGAAGATTCATAGCTAGCACCTTCTAGGTTGCTTGCGGTGATAAGGTACTTTGACACTATCACGCGCC
CCGAGGTATAGAAATTGTTTCCAGTAATAGTAAGTCGGATGCAAGAAGGTAGACACTCAGTGGGGCCTTCGTCCGTAGATACCGAGTCAATCAACGGAGG
CCCATAGCTAATTGGCTGTGGTGCACTTCTTTGAACACTCGACGTACCGACCAACACTTGCAGCGATCCACCATAGCCATAACCCACCGGTACACGAATC
ACAATGTACTCGCTGCTGTTGCTGTCACTAAAATCTCCAAACCCAATTATAGGAATGCGATAACTTGACAAACTTGCTTGCGGTGGAGTGAACTCAACGC
GTGCTGCTGCGAAAGGCACGTTCGCCCCAAGATTTTCTCCGATAACAGTAATCTCCGTAGTCCCATCAGTTGATGCAACGGAAGGGTACAATGAGTAAAC
CACAGGCGGTGCATATGAGCTCGTGGCAGTCGACAATCTTGATTCTTGATCACCGACTGACACCATCCAGGATAGATTCGCCCCTACACCAGGAACAGAT
GTGCAAATGATTGTGGAATCATTGTGCTCGAGCACTTCCTTCACATGATAGTCTCTTCCTGAATTTCCATACGAAATTCCATCGATGACTACAGTATCGG
GCCCAAAATTGCCTCCTCGAAGAACGACTGCCTGCCCACCGCGAACTAGAGCGTTGGCCGCCCCATTACCCTCAATCGAAGTGATAAATGGTCTTGAATA
ACTAATCGTGGGCGTTGCGCTGGTTAAACCATCGATTGTGACTATCCAAGCAAGGCGATTGCCCACACCAGGTGCGGTCGTACAGAGGATCCGTTCGTGG
TCGACCACGATGGCACAATCCTCAGCCGTGAACTCGTCACCATTGACGCCATATGTCACACTCGAAATGGTGGATGCATTGATGGTGCCAAAGTTCTTGC
CCGTGATAACAACTTGCTGATCCCCACTTGTCTTGATTTCGGTTTCTCCATCCGGGCGAAACACTTTTGTCACAATCGGTCCTGCATACGATGAGTTGTG
TGCAGTCCACAGGGATGCTTGGCCTTCGATGGTGACACGCCACGAGTGGAACGAGCCACTACCAGCCACAGACACACACTGTATCAAATTATGATTGGTC
GGATCGTTGTATTTTCGTTTGCAGTTGACACTGCGAAGGATCGTAACATTGTCGAAAGAGTACTCGACAATGGGGTCCGTATAGACAGCACCGTCAGGTC
CGAAGTTTTCCCCGCGGAGTTCAAAGACCGTTCCTCCCGCGGTAGGAACATCTTTGAAGCCCATGACTTCAAAGAGTTCGGGGGCCTTATAAGAAGTTGT
GATTGTAGTAGTCGAGTAACTCTTCTGATCATCCACGGAAACCTGCCATCGGAATAATCCTCCAGCTCCGGGTTGAGATAAACAGGATAACTGCACGTGA
TCAATGACAACCTTACAGTCATCAAGCTCAAACGAGTGAACGTTGTTACTATACCACACAGTGACTTTGCCACATCCCTGACACCCGTATCCAGCTCCGT
TCACCATTACGATGTCACCTCCGGTGGTCAACATTCCGGCAGCCACAGTTACATCAGAAATAGTCGGAAACGCATAGTGACAGCTAGATGCGAAAGCGGT
GCTGGCCTGACCGCGAACTACCACAACGAATGCGAGATCAGCGCCTGTACCAACAACACTGCGACACGCGATATAATGACCTGTTGCATCTTCGCGTACC
TCACAGCTTTGGGCTTCGAATTCGGAGCCATATACAACGACAAGATATGCATCTGCGCTTGTTATCTGCGTTGACCCCAGGTTTTCACCATAAATCCTAA
TATTGTTTGTGTTGCTACCATCGGTCGGTAGCGCACTGTTGCAGACAACAGAGCCTATAACCGGAACACCATAGGATGCCAGGGGAACCGAGGAGGATGC
TTGGAATACGGTTTCTCCAATAGTTGGGACCTCCATTACCAAAGTAACGTTCCAGTATAGATTTGCGCCAACACCTGGCGTTGACGTGCATGCAATTCCG
GTGTTCCCATTAACGAGCCCACAGCTTGTAGCGCGGTATAGTGCAGTGGCTCCATACGCCCCATATTCCACGATGAGCTGCTTGATTACAACTGAGTTAT
CAGCTCGTTGCTTGAACCCAATGTTTGAACCAGTGAGTAAGAACCTTTCACCCCCCTTCGTATCGAGGTCTGAGGAGCTGGTATCCATAAGTCTGAACGT
ATCAATAGTAGTATCTAGAACGTCAACCACTTCGACCGCGACCTGCTTTACAATCGTAAACGCATTGAAACCACTAGAATCACGAGCTTCAACGCTCACT
GTATAGGCTTGAACAGCCTCGTAGTCTATCAGCCCATCTACTATCAAATCACCGCTTGCAGCATCAATGCGGAATACATTCAGTCCTGGTGGATACACAT
CGATCGCGTACCGAATTGTCTTGAATTCGTCAGAGTAAATATCTGGGTCTGCCGTCTTGATTTGAAGCAAGACCGAGTTAATTGCCGTATTTTCGAAAAC
AGAATATGTCGCTGGAACCCCAATAAATGAATGAATCTCATTTACATCCTCCACTTCAACTGTGATACCAGCCACCGCAGTCAGCTTACCAGCATCCTGA
GCAATCAAAGTGAAGCTGTAGACTTGTCGTACCTCGAAGTTAAAGCTTTGTTTGACCACAATCCTAGCACACAGCTCGTGGCTATAGTCCTCTTCAACTT
GTACCGCGAAAAGAGAGCAATCAGCTGTATTTGCACACGAAATCGTGTAAGCAAGTGAATAACCATCGCCTTCGTCAGGATCAGCCGCACTGATACAACG
CGGAAGGGCTAGATTCACCGCTTCATTCTCTTTTATCTGGAACGCGTAAGACTGGTCACTGAATACAGGTGCCTCGTTGACATTTATGACCTGAACAGTG
ACGTCTTGTGTACTGCACATGTGTGCTGGGTCACATGCCGCTACTGTGCATACGAATGCGCGTTTCTTCTCGAAATCCAAAGTGCGTCCTGCACGAAGCG
TCAGAGCGCCATTTGCCAATCCAAGGATAAACATGTCTGAACAGTATGTGTCGGCTTTCGACTGCAATGTAAACTGAATTGGGTCGCTGTCTGGATCACT
GACAAAATGAGATAGGGAGGCCCCCGCTTGCATTCCTGCCCCTGAATTTTCAGCTATCACGAGTGACGACGGCAACGTGCTTAACCAGACAGGTGCAAAG
TTTGACTTTGTCGTTAGAACTTGAATGAGTCCGTTACCCGAACAGTGATCATAGCTGGTGTCGGTAACAGCAACTTTCACATAGTATTGAGCCGGGTATA
CCAGCTCGGCGTTTAAAGGGTTCCGACCAAGTCTAAGTTGACCTGTCAGCACGTCTATTAGAATCAAACCCGCTGAAGCATTTGTCTCCAAGATGCTGTA
CGTGAGAGTATCGGAAACATCTTGGTCTTTACCCGGAAGTGGATAGCCAATTTGAGTGGTGACAGAGGATCGCTCTCTCACCGTGAATGTTAAAGAAGCC
AGCACGGGGCAGTCATTTGCGTTGAGAACAGTCACAGTTATACGACTCTCAGTATATAGAGACGTTGTTTTCACTGTCTTGTCTGAAATTCGAACTGTAA
GCACATATTGAGACTGAGTTTCGTAATCTGGCAGGGATGATCCTTTCCAAACTAAGCCCACTTGACCGTTGATGCATACAGTCGATTCAAGAACCCCTGC
GGAGACTAATCCATTTACTGTCGTGTCATCCACCAACTGGAATTGTGCGCTAGTCCCGATAATTTGATAGAACGAGCACGATGCACTGTCTGGATCAGTA
GCGCTAAACGTGCACGCGGCTGTGCCTTGTTCGTTCAAAATAGTCGGGGTATTCTCCACTATTACACAAGTAACATCACTCATCAAAGGCATCTCGGGGA
CATCAGTAACCGTTACTGTGACGTAGCCACTCCCACATAAACTTGTCTGCGCTGCATCGCAAACTCTTATGTTAAGATTGAAGCGAGTAGGGTCCTTCTC
AAAGTCTAGAGAGCGTGTTGTCTTCAAAGACCCCGTCTGTGGATCAATTTGGAACGGTGCAAAGCTATCCACAAGGGCAAAAATATTGTCTGAGCTGCGA
TCAGGATCAACATACCTTGCTACTAAAACACTAGTACTAGCAGCCATATTCTCTGGGACAGACCCATTGATGCCAGTAACAACCTCAGGAGGCTCGTTTT
CGTCGAGTACGGTGACTGTAACGTTTAGATAGGACCAATACTCACCGTCAGAATACGCTACTTTCAGCTCATACTGAGCTTTGCTCTCAAAATTCAAAGA
CACAAGTGTTTGCAGCTGACCATCACTTCGAATCGAAAACTCTGATTCGTTTCCACTGGAAATACCTTCTTTTATCAAAAACCCATAACTGCTCCCCACA
ACTCCATCAACGTCCACGATTTGAATAGGTCTTCCAACTAAGGACCCTGGAGAGAGATTTTCTTTTATGACGAACATATCTGCCAGCAGAGTGGGGGGTT
CGTTGACATTTTGGACCGATAAAGTAATAATAGTAGATGTAATAATTGGCCCACACTGAGACTCCTCCAGTAGCATGTGGCATCCCACTCCATTGTCTTC
GACTGTAATTTCAATATAGAGTACTGGCATTGTTTCATAGTCAAAAGGAGCCATCGAATACAGCCCACCGTTCCCGGAAACGCGAATATAATCACTAGCA
TTCGTTCGAAAGAACAGCTCAGAATTCTTATCAGGATCAGTGGCCACTACAGTCCCGATAAACGTTCCATTAGGTTCGTTTTCTAGTATACTTTGAGAAC
TAGAGTGAGCGAATTGAGGAGCCTCATTTACATCAAGTATCGTGACCTCCACGATTGCTTGCGACTCCAGAGCAACAGGATATCCTGAATCAATAACACG
GACGCCAAAGGAATAGCGATTGGTACTTTCGTAGTCTAGATTATCCCACTGTACTACCAGTTGCCCAGAGCAACTTTCGAGCCGAAATGGCAAACCGCCA
GCATTTCGATTCACCAGCTCATATCGTAAATTCTCGGTCTGACCACGATCCGGATCAATAGCACGCATGGGCGTTCCAAATGGTAGCCCCGATATGGAAT
TTTCAGGTACGCTGAATGAATAGTATGCTTGCTGGAAAATTGGAGGTTCGTTAACATCCAAGACTTTGATCTGAATTTCGCGGTCACTGTACAGACCAGC
TATATCAGAAACCTGGATGCGAACCATGACCAATGAATTCTTCTCGAAATCAAAACTTGAACTATTGCGTACAGACACATGTCCAGCCGGCGTCAATAAA
ACGTCTGGTGATGGAAATGCTAGTTGAAATGCTATCCGATCGTTGAAGTCGGGATCACTACCAACAAGCTCACCAACCATGGTACCAACAGCGGGATTCT
CTTGAATCTCGAAATAACTATCAGAAAGGATGGGTGCCTCATTCACATCATCAACAAAAACAAATAATGTGGCCTCTCCCAGTAACCCCTCGCTATCGAC
ACCAATCACAACGACTTGCAATGGCTGGTCGCGGGAATCAATGTCTTCGTAATTGAGCGTCGGGTTAGTGAGAACCAGCTCTCCAGATGCCGTGACACCA
AACCAATCGCTCTTTGAACCATGGAGAAAAAAATCTAAAGAAGCCGGATACGCACCAAAAATGCACAGCATGCTCGTTGATGTTGTGTCAGGTATCTCAA
ACACCCCGAGGACGTTTTTTCTGATATATATATCGAAAATAAGCGCACTTGCACTACTTTGTGCTATTGCAGTTTGACCGCCACTCTTTATGAATGAGTT
CTTCGATACCCACTCTGGAACAAGGTCAGCATCCTGCTCGACCAAAACAAACAAACTGCCTCGGCTCGCTAAAAACAGCGCGGTACTCGACAAAGACACT
GCTGTAGGTGTGGATATCACGAAGGCATTTGCCAGCTGAGGTGGAATGTCTATCCATTCGAAATCAGAAGAACCAGAGAATACAGATCCTTTTTCTTTCA
GACTTGACACTATAGCATTGCCTCCAGCTGGTTCGGTCAACGTCAAATAGTATTCATCGTCGTGCTCTGGATCGGAAACATTAATATAGCCTAAGCTAGT
TCCAATTACTGCGTTTTCATACACGCGGTACGCTTTACCAGTGAGAACAGGTGCTTCGTTGATATTCAAAATGAATATCCAGACGGTGGTAATCGCAGTT
GCTTGGCCATCTGAGCACTGAACACTGAGTTCATATTGCCGTTGTGTCTCGAAATCAAGAAAAGCTGTTTCCGCATACACAATTCCACTTTTATGTTCTA
CACTGAAGGCTGCCGTATCGTTAAGAATGTTGAAATATAACTCGTCACCGATGTCTTCATCAAAGCAAGGAATCACCCCCAGTTGCTCTAAGTTTCGCGA
GTGTGTAGATGCGGCTGGTTTCGATACTACCGACTCTCTTGCTGTAAAGTTGACAGGCTGTAGCACTGGCGGATCGTTCACATTCAAAACCGTAACCAGA
AGCGTTGCCGAAACATGAAGTCCTGCAACGTCGGTTGCAACAACGTTAACGGTGATCGACGGTGTAGTTTCGAAGTTTATCTTGTAATCGTCGACTACTG
TTAGCACCCCAGTTGCTGCATCGATATTAAACTGTGAAGAGTCCGCATTTTGCAACGAAAACTTCAATATATCACCAAAGTCTTGGTCGATGGCTTTTAC
GTATCCGACGATCGTACCATGTGCGCTCATTTCTTTCACAACTAGAGACTGCTCTCCAGAAATTGCTGGAGCTTCATTCACATCAATAACACTAATCACA
ATGTCGTTGCTGCAAGCGAGTGAGGCACCAGTACTTGGAACATCATTCGCTTGATAACGAATGCGATACAGACTTTGTGTTTCAAAATCCGCGAAAGTAA
GTTGATTCGCAGCAAACTGAACTACGCCAGTGGCGTAATCGACCGCGAACGATCGACTATCATTTGTGGAAATCAATTGAAAAACGTGATTTTGCCCAGC
ATCCTTGTCTTGCACTACTATCTGGCACAAACCTTGCGTCCCAGGCAGTCCTCTGTTAATCAAAGGAGAATTTTCCAGTATCCAACACTGAAAGGGCGGG
CAAATTGGAGGCTCATTGTCGTTTACGACCGAGATAATCACATTGGTGGAATTCGTTAACCCTGATGAATCAGTCACACGTGCACTAAGCTGATAAGCTT
CATTGTTGTCTGCATATAAAACCCCTTGCTTTATCAGGGATATTACTCCTGAGTCAGAAGATATCGCAAAGATACTGCTCACATCTGAGGTTGCAGTATC
CTCCATATTCCATCCATACTGAATTGTATCGTTCAAATCGGGATCTGTAGCTTGGACGACACCAATAAGCGAGCCTCCAGGGGCCAGTTCATGAACAGAT
AGCTCATATGAAGATAGTCTGAACACAGGCGATTCCGGTGCATCCGATACCATAATTGTAAAATTGAAATTTGTCGAGGTGTTATCCGATGCGGTCACTG
CCCCTCGTATGGTTAGCATTGGCTCAGGCCCACCGAAATTCACCTTTCTCATGGCTTCGTAGTCAAGAGCTACTTTCGTTGTTGCTACCCAACCATCAGC
ATCAATTGTGATGGCATTAGCGATAGGACGCGAATCTTGTAGAGAAAATACAAACTTGTCTCCTTCCGGGTCCATGCCCTGAAGGTGGCCCAATACATGA
CCACTTGCAGAGTTTTCAAATAGCACAAGATCTGACGCTGACGCTTGAAGAAGTACTGGGGGCTCGTTGACGTTTAGAACAAATATGAATACGGTTACGG
TATCTGAAAGAAAGCCTTTCCCCGTATCTGTGACGATTAACTGCACCCGGTGCACCCGCGCACTCTCGTAGTCAAAGAGCTCGCGACTGTATAACAGGCT
ACAGTTTCGATCGGTATCTTGAACCACCCGAGCGAAGGAAGCTGAATTTTCGTCAATCGAATAAAACAGTCGCTGGTCACTGTCCTGGTCTATCGCTTCG
AAGTGATGCAAGATAGATCCAACTTCCACGTCCTCATATACTTGGAGGCAGACGTGCTGGTTCTCTTCGTAGCGGTTATCAGCTGTGCCGTCTTCACGAA
CTAAGCAGTTCCGGTGTATCTGTGGTCTCTCATTTATGTCCACAACCCTAATTTCGACTTGTGTCACCACTGAGTTTAAAGCTGTGTCTTCAACAGCAAC
CTCAAACGTATACAGCGATTGAGTCTCATAGTCCAAATCTCCGGCCACATGAATTTGACCCGTATTGTAATCAATTGTGAAAGGTACTCCGTTGGCCTCA
TCAGGTAGTATTGAGAAGTGCAAAACGTCATAACCATCCGGATCAAATGCATCGATTGGTACGCCGACCAAAGCATATAGGGGCGTGTTTTCTTCAACAG
ACTGTTCCAATACGTTTGCGACGTGGGGTGGTTCATTGACATCCAGCACATCAATAATTATGCTGCACGTGGAAGACAACGACGATACCGTAACTTGTCC
CGCAGAGTCGTTTCTATAGACAAAACTATCACCAATCTTTACGGTTATCGTATACATGGCCACATTTTCATAGTCCAAAGTGCCTGAGCGTTGTAACTTT
AGCCAGTAGGCATTACCACGGGGCTGAACCTCAAAAATATCGAAAGCAATGTCACCTGTATCACTGACAACTTCAAACACTGTAATCGTGTTTTTGATAG
ATGAATCCGGATCATTCCACTTAAGAGGACCGAACCTCTCGGATGCCGAGGCATTCTCAAAAACAGAAAGTCTCATGTCTTCACAGATCGGCATGTCATT
GATGTCGATGATTTCTACTGGAATTATATCCGACAAAGTTTTAAGACCAGTGCGATCGGTTGCACTTACTACTAGCTCGTATCGATCGTTTATTTCATAG
TCGAGAGAATTAGATTTAGACAACCGCACTTCTCCATCACACGAGTGTATCATAAAAATATCGACAGATACTCCGCTCTGATCCAATGCAGTTTCGATCT
GGTATGAAATAACGTCGTACTCGTCAGGATCATAAGCAGCTCCCACGATACCCACAACTGTCCCTTTCTGTGAATCCTCAGCAATACTCATTTTTGCCTG
CGATGTGAATACTGGTGGTTCGTTGACGTCCACAACATCGATTCGCACTATCGCGCTTGAGCGAAGGTTATGGCTGTCCACCCCAGTAACATAGAGATCG
TAATACGACTTTAGCTCGTAGTCAACAGGGTTCAGCAGCGATATTAACCCATCATTCGAAATATGAAAAACATTCGATGAGTTTTGTGAAAGTGACGTGG
AATCGTTTTCGGGGTCCCAGAATGTCACCCGAGCGTGGCTACCATCAGTTGCTCTCACCCAGTCTAGCTCTTCATTGACAGATTCTGGCACCCAAAACCG
GCCAGGTTTGATAACCGGAGGCTCATTAATGTCAAGCACAAGTAGCTGGACTGTGGCAGTGCATGTGAGGCCACCTCCGTCCACAGCTCCGACCTTAAAT
GATATTTGGCGTTGAACCTCGTAGTCAAAAGGGTTGTTTACTACGATGTCACCCATTTCTGAAACAACGACGGTGATATCTGTCATTCCGTCACCGATCA
TGTAATAACTCAGCAACCCCCAAGAAATTGAGGTATTTGCATCTGGATTGATCGCCACGACTCGCCCAACAGTACCAATCGTGTTCTCTGTTATTGCAAA
TGTCATGATAGGCTGTTCAAAGGTGCACTTCTCGTTCTCGTTCATCACATCAATAATCAAAGTACCAGTAGCTTGCTTGGTTGGGCTGCCGTCATCATGA
ACTTCCACGGCTAGTTGTATACTACGTACGAACTCATAGTCAAAAGCACTGCCGTCAAGAACTATAATGGAGCTTGAAACCATGCCCACAGTTACCACGT
CGTTTTTTGGCCTCAAAACAGTGGAGTTGTCCCGCAGAACCAAAGTAGTTTCAATCAAAGTGAAAAAATGGTTCTGGTTGAAATCCTCGTCGGTAATGCG
TATAACCCCCACGATAGAGCTTTGATTTGGGTTCTCAATGATCGAAAAATCGGTAGCGACAATGGTTGGAGCATCATTTCTGTCTAAAACAACGATGTCC
AATGTCGCTGTAGTAAACAGATTGCCACTATCAGATACTACCACTGAAAAAGAGTAGTGCCCCTTTTTCTCAAAATCAAGCTGTTGTCTCGTACGAATAA
CCCCCGTAGTTAAATCGATACTGAACGTTGGATCAACAATCTCAAAAATCAACGTGTCACTAAAATCGGGGTCGAATGCAACCATCTGCCCAGTCAAGGT
TTCACTAAGAGCTGGTGACGTGAACACAGAAGACCCAATCTCAGCATCTTCAGCGACATACAGCGTTTGAGGATATACCTGAGGTGGTTCGTTAATATCT
TGAATACGAACAGACACCGTAGAAAAGCTCCATAATCCTCCTGGCCCATTGTCTGTCGCAGCAACTAGCACCGTAAAGAGTTGTTGTCTTTCAAAATCAA
GGGCTAGTTGGTTACTTACGACCAGGCTCCCATCTCCACCAAATGATAATATTGAAAAAGCGCCTAAGTCATTTCCATTTGCGATGGTATACGTAATGGT
GCTGTTTTGATACTTATCACTGTCGACAGCGGTGATACGCCCGACTAGTGTTTGAACTGGTGCATTCTCCACAACGCTGAACATGTATCGATCAGCTTGA
AAAACGGGTGGTTCATTGCTGTCCGTGACAGTCACGATTACTGTTGTATCAGCATATTCCTTCTGTTCATCAATTACACGAATAAATAGGCGGTAATACT
GCTTAGTTTCAAAGTCCAGCAGTTTTGTAAGAGTGATTATACCTGCTGCTGATACCATGAATGCACCCTCATCTCCTGGGTCGGTGTCTACCATTTGAAA
ACCCAAAACAGAGTTCTCATCAACATCAGAAGCTGATAGAATGCCAATCATGCTACCTTTGGTTGCCGTCTCAGCGACCGCAAACTGGTACAATTTCTGT
GAGAAAATTGGGGGCTCGTTCACGTCAATAACAGCTAAAATAATCGTTGCCGTATCCGCAAGGTGCAATGATGAAGTATTGGCATTGTATGCGCTTGTAT
CAGGAAGGACAATGTAGACGACACACACCCGCATGGTTTCATAGTCCAATCCGCCAGTTGCAAGGGTAAGTTGACCACATGAGTCAAGCCAAAATGTAGT
ACGGCGACCACAAGTCGTGTTTGTAATGACCATCTCAACCGAGCATCCCACAACAGTATTCAAGTTTTCTTCGTCAACAACAAAAGCAGTGAGAGGCTTA
CCGATAGCACTACCAACATCAATATTCTCGGTTACATCAAATTGAATCACTTCATGGTCGAAGTATGGCGGTTCCAACACGTTAATAAGATTAACGCTGT
ACCTGGATCTCGTAGTCAGATTCCCTTGGTCTTGTACACAAATATCCACCCAAAGCGATGGCACATATTCGAAATTGAGAGCAGTGGAGTTCTGTACGAT
AATCTCTGCGCCGTTGAAGCCTCTATTTTGAACGCGAAATGTTTGTGAGTGGCTTTGCTCGCAAACCCAAAACTGGTGCTTGTCCCCGTTGTCGGGATCG
TGAACCAGTATGAATAACACAACTGTTTCATCTGGCGAATTCTCACGTAGAAGTGTAGTAAGAGATCCCTCCAGTATAGGAGGTTCATTAACGTCCGTTA
TGTAGATCACGCTCTTGGAAACCACAGTGAACTCTCCATCAGATGCTCGCACAACGATAGGAAGGCTATTCCCGAAAGAAGACTCAAAATCTAGTGAGCT
GTCACTTTTAAGCATTAACTGCCCAGAAGATGAATTGATTCTGATGCAGTCCAACACAGGTTCACTTGAACCAACGAGATCATACTCAATAATGGAATCG
ATATCCTCGTCGACTGCAGTCACCGGGTCTCCTATGGCTGACCCAGGTGTAAGGTTTTCTGGTACAAAAAAATTGAAGGAACCAATTTTTGGTGGCTCAT
TGACGTCGTCAATGTATACAACGAAATCGGTTTCATCAGATAAGCCGCCATGGTCAATAACACGCACACGTAACTTGTACACGGACTTGGCTTCATAATC
TAGACGACCCGACAGACTCACTTGACCTGACCGTAAATCGATGGCAAAGGTTGTCTGATTAGTGATCACAAGCTCAAAGGAAAACACTTCATGGCCATTT
TTTAAATCGGGATCGATAGTGCTGTCGACAAAATTTCTTCCCACAAGTGTACTAATAATTGCATCTTCTCGTACAGACGTACTTTGGACTCGGATTGTTG
GCCTCTCGTTAATATCGATAACCTTTACAGTAACATTGGTAATCGAGAATAATCCAAACGCGTCTCCCGCTCTTACCAGTAAAGCGTATTCGCTTGTTTC
CTCGTAGTCTAGCTGTTCCGCTTGCTGAAATATTACGCCTGTCAGGGTATCAATGCCAAATGATGTTGGGGCCCGTGGAACTCCACTCTCCGGTGACTCC
GAAACGATGCTAAAAAAAATTGTGTCACCGTCTGGATCTCGAGCTTTCACAGCAGGTAAAACATTCGTTAAAACAGGTTGGTTTTCCGAAATATTCAGTT
GCATCGACTCAACGATGGGTGGCTCGTTCAGGTTATTGACCAGAATGTTCACGTTTAGAACGCTGCTTTCGGCCCCCGACTCGTCCGTCGCGATAATGGA
AAGCACGTAGGTTGACTTGAATTCAAAATCAAGCCCGTCATGCATTAACACAACTTTGTTACCCACAACGTTAAACATGTCCAGCTGGCCAACCAAGCGG
ATTTTCACAGCATCTGGGCGGCCATCATTGCGAGTGTCGGGGTCAAAAACAGTAAGATTTCCCGTTGCTTCAGCCCCAGAACGTGAGTTCTCATCTATGT
CAAAAGCTGTAGCGAGGAGCTGAGGCTTTTCGTTAACATCACGTACTACAATGTCAAGTCTCTGCGGGGGACTAGTCAAACCTCCCAAATCGCTTGCTTG
TACCATTATCGACCAAATACGTTGCTCTTCGTAGTTGATATTCTGGGGCATGTTCACAACAATCTGACCTTGTGGGGTAATATTAAAAGGACTCTTTTGA
TCATTTTCCACGATATCCCACGTGTGTATCTTCCAAGATATGTTCGCTGCTCCATTTTTGTCTTCATCTTGAACCGTGAGACTGCACACAATCTTCCCAA
CTAGTAGATTTAATTCCTGTTCATTTAAGTGATAAGGAAATTCGTCCATTTCACATGTCCGAGGAGACACTATTGTCGGTGCATCATTTTCGTCAGATAA
AATTACTGTAGCAGATCCACATCCTTCTAAAGGTGGATTCCCACCATCCTTTGCGCATACAGTAATTGTGAGTTGTTGGTTAACTTCGTAATTGAGGGCA
GTGGAGTTGGCAACTGATAACATTCCTGAATTCGAATCAATACGGAAATTTAGTGCTTCTGTATCTGAAGTGCGTGGAAGATAATACATAACCCTCCCTG
AAAAAAGGGTTACAGTATCCGGATCAGTCCCATCAATGATACAAATTGATGTCCCGGGTGGTGCATTTTCCGCCAGAAAGCATGTTGCATCGTGCACAAC
TGGAGGCTCGTTTACGTCCTCGATATCCACTGTGACCGTCGAAATTGATGACAGCCCTAGACGATCAGTAACTGCAATCGAGAGGGCGTATTTACTCTCA
CTTTCAAAATCAAGTTGATCAATATTTGCCGTGAGTTCACCAGTGTTTTTGTCCACAAAAAATACTGGACTAACTGGATTGCCCTCGATGATAGCAAAGT
GAACGGTATCGCTAACATCAGGATCCATGTATGGAACCACACCGTCGACAAGGATAACACGTGAGACTGATAAAAGCAAATACGAAAGTTAGAATTAACA
ACAAAAGCTAGAGACCTGATGAAATTTAAATGAAAGCAGACCTTGGGTAACAGTGATTTCAAGAACAGAAGCCATTGCCGAGCTACGGTCGTATGAACTT
ACTTCCCCTATCCCTCCCCCTGATATTAAAAAGGATACACGAGTAGTGTTAATCATGTCCGCCATAACAGGTTCGATAATTGACGCTAAGTTAGGTGACC
AAATAGTAGTTGCTGAAGCCTCACTTTCCACAGTCCACTCCACGAAGGCAGGATTCCCAAAACTTTCCAAGCTATCAGTTGAAATCCACGAATTCTGAGA
GCTCGTCATCACGCGAATCTTTAGTGAAAATGGGCCAATCTTTCCAGATGGAACTGTAAGGCGTAACTGCGCTAATGAAAGTTTAGCGATAAAAGCTGGA
AGTATAACACCCTGAAATTGAAGAACAACGCCCACTGCAGTTTTGCTAAAAGGGTCATATCCCATTTGAAGAGTTGTTCGCGACCAGTCCGTCGAATATA
CGCCAGCCGCGTTCTTTTTGATGCTGTAATCGTCTCGAGACGAAATAATCGGAAATACAAAGATCTCGGTCGTGAGCACACGCAAAGGATCAGAATTAAC
ACCTAATGTCAGTGCATACACACACACGTTATACTCACTACACACATGACATCACATATTAGCGGAGTAGCTTCTTTCTTACCTTCTGGAATACTAAGAT
GGCGATTTTCTGTCAAAGGACTCTCGTTAATATCTCTGGCCGTTATCGACACCACACAGCTCGAACTTAGTGTCCCGAGGCCGTTGTGGTAAGCACCGTC
ATCGGCGACAACAATAGTCGCAACTGTTGTGTTGTGCGCGGCCGATTCGAAGTCAAGGTTGTTCTCGCGAGTTACAAATATCTGTCCATTGGTCGGATAT
ACCCCCAGAAACGAATGTTCAAGTGCAAAAGTGAAGACAGTTCCAATATCTGTATCACTCACGTACGTCGTAAGTGGCTTCCCAACAAGCGCTCCAACTG
GAGAGTTTTCATCCATGGCAAATACAATGTTTCCTCTACAGTTTGGTGGGGTATTGTTTACAAGTACATCCACCAAAACTGTAGTAGTACTAAAAAGCTG
CTTCATATCATACACGCTGGCCATCAGCATAAATGAAAAACCTTGCTTAAGAGCTTGTATGTTCTGTGGTGAAACCACACTGACTTCTCCCGTTTGCGGG
TTCACAGAAAACACACCAATACCATTTATAGTGGTAGCAGTCAGTAAGGTTTCAGATGACTGGAGTGAGAACGACAATGAATCCCCGTAATCAGGATCAA
TAGCTTGAAGTACGCCAATTACGGATCCCGTCGCGGCGTAACGAGATACAGAAAACTGGATAAGTCTTTCTGTTGCAGGTACAAAGGATGGAGGCTCGTT
GCAGTCCTCAACATTTATACGAAGAACGCTAGACGTACACAGGGCAAACGGGTCGCATGCTCGCAGGGTGACCTCGTAGAGAGACTTCTGTTCGTAGTTC
AACGAGGCCTCCAAAGTCAGTTCGGGTGTGGCGATATTACGGATGGCAAAAACGCCAGCATTATTATCTCTGACCACTTGGTATGATAGCTGCTGACCTG
CGTCTTCGTCTTGAACATTCCATACAAGCACTGTGGTTCCAATAGCCGCATCTTCTCTGACGGAAACGCCTATTTCAACGGCACTAGTAGGTACTTCATT
GACGTCTTGAATCGCAATAACGAAATGCTCAATTGAAGACAAAGTGGGGGTTCCTCTATCTGATACGCGCACATTTATCCAAGCTTGATGGAGCTCTAAA
AGCTCAAAATTTAGTCGTTTTGGATCCTCGGCTATTATGAACCCGCTTTTAGAATATACAGAAAACAATCCAGCTGGAGATTGATCTTCAATTTCAAACA
CGAGAGTGCTGGTCTGGTTGAAGTCTGGGTCGTAAGCGTGGATGGCATAAAAAGAAGTGTTACAGTTTTCATTCACTTGAACTTGCTCACTAGCTATGAC
TGGGGCCTCGTTGACATCCACAACACGAATTGTTATTGGACACGTACTGCAAGCACCGCCAGCGTCACAGACTGAAAATGCAAGCTGATACAACTCACGC
GATTCATAATCAAGGGACAAGCGCTCTGAAACAATAGAGCGGCCCTTGAACTGAAATCCAGAAGTCTCCTCTTTATCGATTATAGTGAAGGTCGGAATGT
TTCCAAGATCCTCC