Description :
From Genome Similarity Track
Location :
Scaffold_60:37302- 40781
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_60-fgenesh-gene-0.8Prolyl endopeptidase
Pytve_DAOMBR484maker-pve_contig_60-snap-gene-0.36Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_60-snap-gene-0.48Nonribosomal peptide synthetase

Sequence
3479 bases(100 bases per row)
CAGGTCAAGGGCTTCGACCCCAGCTTGTTCGAGGCCACGCAGGTGTTCTACCCGTCCAAGGATGGCACCAAGATCCCCATGTTCATCGTTAAGCGCAAGT
CTGCACCGCTGGACGGGAACCAGCCCGTGTACCTGTACGGCTACGGCGGGTTCAACATCTCTCTCACGCCAGCGTTTAGCGTCGCGCGGCTGATATTCGC
GCACCACTACGGCGGTATCCTGGCGCTGCCGAACCTTCGCGGCGGCGGCGAGTACGGCGAGCAGTGGCATCAGGACGGCATGCTCTTCAAGAAGCAGAAC
GTGTTCGACGACTTCCATGGAGCGGCCGAGTACCTGATCAAGGAGAAGTACACGAACTCCGAGCGGATCGCGATCCACGGCGGTTCGAACGGCGGCCTGC
TGGTGGCGGCGTGCATCAACCAGCGTCCCGACCTGTACCGCTGCGCTGTCGGCGCTGTCGGCGTGATGGACATGCTGCGCTTCCACAAGTTCACGATCGG
GCACGCTTGGCGGACGGACTACGGCGACCCGGACGTCGCCGAGGACTTCAAGTACCTGCTCAAGTACTCGCCGGTGCACAACGTGCCGAGCGCCGACAGC
CCTGCAGTCGCTGCGCTCGCGGATCGCGGCGGGTTCCCGTCTGTGCTGCTCACGACGGGCGACCACGACGACCGCGTCGTGCCGCTGCACTCGTACAAGC
TGATCGCGGAGCTGCAGCACAAGCTGGGGAACTCGTCGGCGCAGACGAACCCGCTGGTGATCCGCATCGACACCAAGTCGGGCCATGGCGCCGGAAAGCC
GACGACGAAGATTATCGAGGAGACGTCCGAGGTGTACGCGTTCATCGCCTGGAGCATCGGCGCCGAGTTCCTCGTGTGACAGCTTCAACCGCGAAGCCCG
TTGTGACCAGAGAGATCCAGGCCGTTGGAGGTCCGGATTTAGGTGCCGCGCGACTTTACCGGACGAGGCAGTTACAGAAAGGAGAGGTGAGGCGGGAGTG
CGTGAGTGAATGACGACCAAGGGAGGAGTGAGTGTATGGTTCGAAAGGCGTCGTGCGCAATGGGAGAATGTGAACCCGCCTGCGTCTGCAGAGTTTTTAT
GCCGGGTTTACGAATTACTGGCAGGCAGTAAACCGGGATAGACAACGTCACTGACGTCGTGGATGGCCTCAGCGACGCATGCGGCGAAGGCTGTCAGCTC
CTACTGTCCGCACGGCGGAGCCTCGTGTGGGTTCATTCACATTGAAGTTGCCGGTGGGACACGAACGCGCTTTCATGCATCCACTTTTGTCAGGCGGCAG
TCCGTCATTCGCGCGGTTGCCGCCTTCGTTGACTGGTCGAGGCGCAGTCATCCTCCGCGAGGTGGCGGCCGGCGCGCGACTGGATTACGTACGGCGGAGC
TCATGGATGTTCGGCTGCTGCCGTGGAAATCCGGCTCGAGCCGGGATTTGCGTGCATTTTGCGTGCGCTCTTTTTCGCTACATCCGTACCTTCGGCGCAC
CGAAAACCTTGAAGTCGCGGGTTCCAGAAGAAGGACACGTCACTCTATCGCCACTATGATCATCACAAGGCGACAACCCTGCGGCGGCGTGTGATTTCAT
AGTCGCAAGCGCCGGGCGGCGGCGGACCAGCAGCGTTCCGGTCAACCGTGCGCGCCTTGGCGCAGGCGACCGCTAAGGCGCACCGGTAGCGGCAGCGGCC
CGGCAAAAGAACGGCCGTGTCCGTTCGGGCGGTTGGCTGGCGACGCGATGCGCAAATCACCCGGACAGTGCAGAGAGCGATGCCAAGCGGCGGATTATTT
CTCGTCATTCGCGGATTCTTCCGTCGGCGATAGCACGCGATAGCACGCGACCGCTCTCTCTGGAAACGATGGCATCCGTGCTCTGGGTCGAGCTGCGCGA
CGTGCCCGGCTGTCCGCGGCGGCTCGTGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCG
CGGCCGAGGTGTTTGATCTCGCGGCGACGCGGCTTGTGGTCGTGGACGCGCGGGTCGAGAGCGAGGGCCAGGCGGCGACTGTGCTGGTCGAAGGCAACGC
GCAGGCCACGCCGGTGGCCGTCACGGTCTCGACGGCGGTGCCACCCGCGCCGGTGGACGCGGCCGCGGTCCGCGCGTTCATCGCGGGACTGCGGGCGGCG
AATGTGCTTCCGCTCGTGGATGAAGACCGCGGCTGTCGCTACGAGTACGGCGNNNNNNNNNNNNNNNNNGAGCCGGAGGTGCTCGCGCTCGCGGACGGCG
TGCGGTGGCTCGAGTCGGCGGCGCCGTCGCGGCTGTANNNNNNNNNNACCGCGTGCTGCTGATGCTGTCCATGGCGTTCCTCGACCAGCGCGACGCCGTC
CACCAAGTGCTCATCACGGGCTCCTTCGGCGTGGGCAAGACGGCGTTCCTGAGCTTCGTTATGTGGCAGCTGCGGCTCGCGGCGGACCCGCCAACGGTCG
TGCTCGACGTCGACGGCTTCTTCGGGCGGATCGGCGCGGACGGCGTGGTCGAGGTAGGCGAGCGCGGCCGCAGCTTCGCGGACGACCTCGCCGAGCGGTC
CACGGTCTACCTGTGCGACGTGTCGGCCGCGTCTGCGACCGGTGGCCCGCTCTGTGGACCGAACGTGCTCGCGCGGACGATCGTGACGGCTGCGCCTGTC
CGCAAGCTGGTCGCCGAGTTCGAAGGCTGCGCCGACCGCCGCACCGTCACGTTTGTCATGCCGCTGTGGACGACCGCCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGCACGTGCCACGCGAGCACCTGATCGAGCTCGTGCACATGTGGGGCGGCACGGCGCGGGCCGCG
CTCGGGACGCAGTTCGCGGACGCCAAGGAGCAGTTCGTGCGGTCCGCGGCGGCGCTGCCGCTCGGCGTGGCCGCGCAGCTCGTGCGCGACCACGGCACGG
CGACGGAGAACATGGTCGACGCCGACGGGTACTCGGAGGCCGGCCACCGACTCGTCCACATGGACGTGGACGCCGACAACCTGTTCAAGCTCCAGTCGGT
CGCGCTGTGCAGCGCGAACGCGTGCGCGATCGTGCTGAGCACGGCGGGCGACGGCGAGGTGGGCAAGCTGATCGAGACGCTCGAGGCCGACCTGAAGCAC
CCGACGGACCGCATCACCGAGCCATTCAAGCGGCAGCTCGAGCACGAGCACTTGAGCAAGGTAGTGAGGGCGTGAGTAGCAACATGTGCGCACAGTCGAA
GGCGTGCCATTTGTATGGTTAATGAGATTTGTACCAAGTATCAGCACGGAGGCTGCTCCGTCCAATGTTCGAACTGCTCGCGGATCGCGACACCCAGGCT
GTCGACGTGCACTGGTCGCAGCAGCGACAGGTGCGAGCTGCCAGGGAACTCGACGGTCGCAATGTCCGCTCCCGCTGCT