Description :
From Genome Similarity Track
Location :
Scaffold_72:37301- 38710
Transcript NameFunction/comments
Physo_139238hypothetical protein

Sequence
1409 bases(100 bases per row)
TTCTATTAAAACTATTTTCTGAGCCCTGCTCACCTGTCTTTTGCTGCCAGTCCAGGAAAGCCAAGCAGCTCGATCATGAGTTGAGGCACCTAGATTAGTG
TGCTAGGATACAGATTATCAATTCAAGGTAAGAACTTCACTCCATTCACGAATACCTCTGATGCCTGAAATCTGCTTTTCGTGACGTGTTGATCCAACAA
CTTTCAGCCCTGCAGGGTAATGTTTGACGCAGGTTCAGCCAGAATCGCATCTTCACCCTCGCAAATGTCCTTCAGACCTTCAACAGCGTAACTGTTTGCT
CCAGCCAACATGAACGAGGACAGTTTGTTGACAAAATTCACTTTGGAGAAGTCAACGCTGCCGGTGGCGACAATGTCAGAAACGCGGAGGGCGTTGCCGG
TGCATTCGCTGCCGTCGTAGAACACGAAGCGATAGCCATGAGTAGCCTTCAACCAAGCAGCACGGACCGCAATGTTGCCGTAGCAGGAGTCGAGCGAGTA
GCACACTTGGGTCTCGGAGAAGGTGAACTTCTTGTAGCGAGGGTTGAGTGACGTGGGTTGCTTCGGAAACAGTCGGAGCTCCACAGCAGAACTTAGGCAC
AGGAGGGAAGCCACAAGCGCGACGGCGAGCAGCAACACGGTGGAGGTTGGCATGGACATCCCGGATGCAAATTGCAGAATGACCTGAAATACAAGGTTCG
GATCTTCAGAACAAGTCATGTCTGTCTGGTATATCCTACTCAAAGCCAAGGCCCTGTCGTCATTCACGTGAATCTTCGCGCCAGCAAAGGGTCCGTAAAT
TGTGGACAAGGCGCTTGGACCTTGGATGCTTCGGCGCTTTTGCTACGGGCTAAAGTGCGTTATCCCCATTTCCAGATAGCCCACGACCCGACTAAAGCTC
ATGCACACGTTTGCTGCGTCGTTGACGGTCGTCATCGTAGCGATTGCCACTGCGATCATGTCGACTGATGCCGGTCATATCTACCTATATGACGGCCCCA
ATATCGATGGCTACTACCTGGATTGGGCGTTCCACGATACCCAGCACTGCTACTCGGTGCCATTCGATCATATTCAGGAAGCTACCCGACGGCGGCCATT
TGGTCCTGTACGAAGAAACTGAGTGCCAAGGCAAGTACTACAAGGTCGCTGCGACGCCGCGCGGGACGCTCAAGTACAAGGACGGAGGGTTTGAGATCGG
CGTTTCGTCCTTCATGGTTTGGTCGTCGGGGATATACGCCACGAACGGGTTGACCAATATCTGCGAGGATCACGACACAGAGAGGCTTGCGATCAACTCG
ACTGCTAGCGTACTGGACAATGCTGGGCGTTGAGAAGGAGAGAATCGAGTAAAGCAGTGAATTTACAGAGTCTATTGTGTCATTTGCACTCCGAACTTGC
TATCAGGCT