Description :
From Genome Similarity Track
Location :
Scaffold_1457:373- 2793
Transcript NameFunction/comments
Phymu_g13304calcineurin-like phosphoesterase, putative

Sequence
2420 bases(100 bases per row)
CTTGGTCGTCGGGCtccggacgacgacgagattGAGAACAATTATTTCGGGGAAcagaagctcatggaggGTGCACTCATCAAGCTGGGGGACTACGCGC
ACTACCGGTACTTTCAGCTTTTCCGCAGTGGACGTTTCTGCTATTACGAACTGCCAATGCCAGCGGTGACGGCCGATGGAGATCGGAGAGTTCACCTCAC
GTCGAAGCACCTGCGAGGCTTCATGACGCTCCGTGCGTCAAGACACACCAAGAGTTTAGCCAGGAACGAAGAGGAATACGAGGCCGATCTCCTCAAACGC
GGGCTCGTGTTCAACCGtaagaagctcgagatgcaGCTCACGGGGTACTCGCCTTTGGGCCAATTATTGTCCTGGAAGCTTCGTGCCAGCAGAGACGCGG
TGTATTTGAAGTGGGAACGTGCATTTCGCATTGCTCTCCGGCCTATCTGGGTGCAAAACGCGACGCACTGTATGGTGTGCAAGAAGGACTTCACCCTCTT
CATCCGCCCACACCACTGCCGGTACGGTAAACTATGTCGTTACTCGTCCATTTCACCATTGACACTATATTGTTTTTCTTTCATCGTAGCAAATGCGGGA
CGTGTATGTGTGATGAATGCACCGTGCTGGTGCCCCGACTGCCGTTGCAAGGCTACTACGATGAAGTGCGTATCTGTCGAGACTGTTCACCGATCAGCGG
CCAGCTTTCATCACTGAAAAAGGGTACACGCGTCCTGGTGTACGGTATTTTACCAGGTCGCGTAATGGACGTAAGTTTACCCGAAGGTGCTGACGGGAGG
GGGACTGTAagcgtggagctggcgaaACAAGACAATGAGAGACGAAGTTATGCCCTGGAGCGAGTTGAACTCTATTCGGAAGCGGTGCTATCGGCGAACC
GGATCAAGAACGCGATACGAAGGCACTTGGCATACTTAATATTTCGGACGCGTCTCAATTTCAGCACGTGGAACATATTGGAAACGATGCAGGAGCAGCG
CACGATGCAAATGATGCGATTCGTCAAGAAGTCGATGAGTATTAACGACTTGCACTCCATGATGCCGCTTCTGGGCCCACGTAGTACACTAGACGATGCC
GTTTTGGAAAGGGAGCGAGCCAAACTATCTCTTGCTCATTACCATGGAGTCCGGGTACTGTTTCCCTTGCGTCTGAACACAGTGAAGAGGCTGATCAACC
AATTTCGCAATGGAATTTTGCTACACCCCGTGTTCGTACGTCGTATCTTGGACGAATCAGCGAAATTGTTCCAAACGCAACACAAATCTCCAATGAATTC
GGTCGACATCCCCCCTGGAGTGAAAATGGTTGTGGTGGGCGATCTACACGGACAGCTCGAGGATTTACTAACGATTATGGAGAAGAACGGGATCCCTAGC
ACCAAAAACTGGTATCTCTTCAACGGAGACTTTGTGGATCGAGGAGCCCACGGGGTTGAAATCATGCTGCTACTGCTTGCGTTTAAGCTTTTGTATCCCG
GCTGTGTGTTTCTAAATCGCGGCAACCACGAAGAGCGGATGATCAACGAGATCTTCGGGTTCCAGGATGAAGTTTACTCCAAGTACGGCATTGAAAACGA
CAGCAGTGCACGTTGGGGAGGGCTGAGCACGTCCACCAACTACTCGGCGATCAAGCTGTTCCAGATGTTCGAGACTGTCTTCAACTTATTCCCGGTCTTT
GCCTTGGTTAACAggtgcgtcttcgtcgtccacggagGCTTGAGCAACCACGAGAACGTCACCATCGCAGAGTTACAACAACTAGATCACCGGGGAGAAC
CTTCGCAAGGCACCAGCCGCGAGGATGAACTTCTGACGCATCTTTTATGGAGTGATCCGTGTGAGGAAGACGGATGGAAACCTTCTAGCAGGGGTGCGGG
AGTGGAGTTTGGCCCAGACATCACCAGGGAGTTCTGTAAGCGGAATGGCATTAGTCTCATCATCCGGTCACACGAGTGCCGAGAAGAAGGGTTCGATATC
GTTCACGACGGGCTCCTTCTCACAGTCTTTTCGGCGTCCAACTACTGCGGCTCGCAAGCAAACAAGGGGGCATGTGTGTTGCTGGAAAGGGGCGAGAATA
ATGACATTCAACCACGCGTGGTGCAATTTTCAgcgcagccacttcaacaactACGAGCTGCAGGGAAAAACGAGTGGAGAAAGAAAGCTCGGCATTTAGA
ACGGCAAACACTGGAGTCGGTCTTGAAGATCATTTGTGAGAATCAGTACGCGTTAACGCTTGCTTTTAAGCAGGCGGACACGACGAGATGTGGGCGAGTG
TCGAAGATTGAGTGGAAGACAATACTGCAGCGGGTGCTCGGCGTCCAAGCTAACTTTCTCTCGTATTTCCACCTACTAGCCACAGAGTGTGACAAGGGAG
GGATCGATTATCGAGGCTTT