Description :
From Genome Similarity Track
Location :
Scaffold_191:373- 2249
Transcript NameFunction/comments
g17184.t1hypothetical protein

Sequence
1876 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAAGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAATACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAG
TCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGAACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACC
ACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAAACGCCGATACCTCGAAAAGATGTGATCATCGATTCG
ATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTC
CGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGCTGAAGAATGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGC
GACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGATGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGC
TTGAGCTCATGCGAAAGCACAAGCTCTATGCAAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGG
CGTACACCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGACCTGCGGCAGTTCCTTGGACTCGCCACGTACTTG
TGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCGTGGGAATGGACTGCTGATTGTCAGCAGGCCT
TTGAAGTAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGAT
CGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGCCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACAT
GACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGAGAGTAGACCATTCGTGGCTACACCGACCACGCATCGTTGCG
TACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTG
AATATCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACACCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGT
CCTTGCTGGACGAAGTGAAGGCCGCATACGCACAGGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCT
GGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTATACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCG
GATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGCGAGAAGACATACTTGCTTCTCACGCGTG
ACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC