Description :
From Genome Similarity Track
Location :
Scaffold_3445:373- 1743
Sequence
1370 bases(100 bases per row)
GGGGTCCCAGGATCCCCTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTATGATTTTCCCCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATC
CATAGAGGGCGTTATCGAACAGGCGTTGGTAGATCTGGGGCGCGTTCTTCAATCCAAACGGCATCTGGTTCCACTCGAACAGTCCAAACGGTGTGATGAA
TGCGGATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGCCATGTCAAGAGAACAGTACCAGAGTACTTTATCCAAATCTTTCAAT
AGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGTTAGCTAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGA
TGATGATTAGCACTGGGGATGCCCACGGTTGTAAGGTCTCCGGCATCACCAGTCTCATCAATCCATCCGGATCCTCGTTGACTCTCTTCGTAGGGGGACA
ATAGAAGAGCAAGTCATTGAGATCCACTGCATAATCCGTAGCGATAATACTGTAGGATTTGGCATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGA
TACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCCCTTCACAAATGTTTCATCGAGAATCTGGGGGC
TGGATCCAATCCTTCCTCTGGTCCTAGTGACAGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAACGTAAC
GAGATCCTGATGCTCGGCCTCTCTCTCCACTTCGACACCACATTGGTTCCGTAAAGCGGCACTGGCCAAGCTATCTGCGCTGGCATTCCAATCTCGCTTG
ACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGCTAGGGCCGGGACCTTGCAGTCAATCTCACCTCGCA
CTTGTCTGATCACCAAGTTTGAATCTCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGC
TTCATTGACGGTGAGGCTCTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCCCCACAGTATTGCGCTGTATGCTCCTCCTCCACGT
CGTACGCGAGCGGATCCATCGAAACTCAGGATGTACAGATCTTCATCCACTTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAA
AAGTGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACCCCCAGAAT