Description :
From Genome Similarity Track
Location :
Scaffold_486:373- 1466
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_486-fgenesh-gene-0.0Glutathione S-transferase

Sequence
1093 bases(100 bases per row)
CTACGCCGAGGCCTCGCGTCTCGCGCTCTTCATCGGCGGCGTGCCATTCGAGGACGAGCGTATCTCGCACGAGGAGCTCGTGGAACTCGAGCCCAAGCTG
CCGTACGGCCGCCTGCCGGTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGCCGAGTCCAATTCGATCCTGCGGTTCGCCGGTCGCCTCGGCGGA
CTCTACCCGGTGAGCAACCCGCTCGCGGCGCTGCGTGTCGACGAGATCCTGCACGCGCTCGAGGAATTCGAGGTCAAGGTCGCGGCGTGCTTTGAAGGAG
CGACTCCCGAGGCGCTCAAAGAGGAGCTGCTGATCCAAGAGGTGCCGCGCTACTTTGCTTTGATCGACGCGCGGCTCGAGCGCATGATGGAGCTGTCGTT
CTTCCGCGAGAAGATGACCGAGGTGTTCGTGCATGACTTGGCGCTCTACGCCTGGATCACGCGGCTGCACTCGAGAGAGCTGGAGAGTATCACCACCGAG
ATGCTCGACAAGTTCCGCCACGTCAACGAGACGGTGGCCAAAGTGCACGCGCATCCAAAGGTGAAGGAATGGAACGTTTTGTCACATGACGAGCAAGTGT
CGAAGCCCGTGACCCCCGAGCGAACGACCAAGCGTCCATCTGCGACCGCCGACGCGTATCCGGACCCGATGCCGCAGCCCAAGCTCAGACTCGCATACTT
TTTCAGCTCAGGTCGCGCCGAGCCGATCCGGCTCGCACTCGCAATAGGCGACGTTGCATTCGAGGACGAGCACCTGAGCTCCACTGACTTCACCATCGTC
AAGCCGACGCTGCCGTTCCACCAGCTCCCAGTGCTGCACGTCAACGGATACGCTCCCGTGGCCCAGTCATATGCCATCCTCCGCTACGCCGGGACGCTGT
CGGATCTGTATCCTGCGACGGACGCACTGAAGGCGTTGCGCGTGGACGAGCTGCTGTCCGTGCTGGATGAGGGCCAGAACCACCCGCTCTGGAGCGAGTC
GTACATCGAAGATCCGGACAGGAAGCTACAGATGCGCAGCATCATCTCCCGCGACACCATCCCCAAGATGCTCGGGTGGCTCGAGGACCGCGT