Description :
From Genome Similarity Track
Location :
Scaffold_2:37296- 39072
Sequence
1776 bases(100 bases per row)
TTACATAAGTAGGTAGACTTGCATTACAAAAGTAGGTGCAGCAGCACACGAGTAGCGTGTGCTGAACTGCCGTCACCATATCCGTTGAAATATGGGGAGC
CAGACCCATAATCAACCAATAAGGAGCTGACGTGTATTTGAGTGGTCAGGGCAAGCCGCCCTGGACCTAAATAAAAACAGAGTTGATTTTTCTTCAGACT
AAGTACTTGGTTTCAGTATCACTGGACTTGTACGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACAGCACAGGCCCGTTACACCTGGTAGGACTTTG
TAGTCCTTCCCATGACCAAGTTCACGAAGAGCCAAGGTATGACGTTTGAAACTCCAGGGCCGACCCTGGAACATGCTGTTTTCCCTCATCTCACTCGTGT
CGAGTGGTAAGCCCTTTACCGCCTCGCGGCGGTGTCTGGTGAGGCTGTAATCGCGTCGCTCCTGAGCCCAGCGACGTCCGACCAACAGCACCAAGCAGCC
CAAGAGTTCATGGAACGCGAGCTAGCCGATGCGAATCGGCGAGCAACAACTCCCGCGCGTTCCTCGAAAAATGATGTCGTGAAGCTAGAGACGTCTACCT
ACTCCGGTGAAGGAGCGAATTACTTCCCGCTGAACCGGTGGTTGCGCGAGATCGACATCGCGATTGCTTCGAGAATGATCGAAGCGCAAGAGACAATGGT
CAATTTTTTATTGTCCCGGTTGTCCGGGAAGGCCCAGAAATGGGCCCTCGGTAAACTTGTCGTTGATTACGACGCATTCCCCACTCTGGAGTCTCTCCAG
CAAGATCTCAGGCTCGCGTTCGAGCCGCCTCAAGACGAGTCCCGCGTGCGTGCCAAGTTCTTCTGTCTTCGTCAAGGTAAAATGACTATGCGCAACTACG
TTCAAAAGACTCGCCACCTCGCGTCATGCATCGCGACAAAACCGATTGACACAGCATCGCAGGTCCATGTATTCGTATTCGGCATGTGTGAAGGCATGAC
ACGGTACTGCCTGACCCGAGCGGAACCTTCCTCTCTCGAGGAAGCATTCGCCCTCGCATTACGCGAAGACTATGTTGTGGCGGCGTCTTACGCGCGCGCG
ATGTCTACGGCAGCTCGTGAGTCAGCCCCCGAGCCCATGGAGATCGACGCGATTGACGCGTCGAATAATCATCGTCAGTCGACTTCTCGTGGGCAAACGG
CCGTCCCAATCGCCCGCTCACTTGCTTCCGCTGCCGGAAGATCGGTCATCGCGCGGCGGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACACCGCCGAT
GTCTCACCTGCCGTTCAGTCAAAAAACGATCAGGGTCAGTAGGTGTGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGCCCCCCGTGCTACCCAACCTT
CTAGCCCTCCTGTGCTCTACGCACACTTTAATGCCACCACCACGTCGGGCGACTCGAGGCTGATCATCGTCAGTCTTCATGTCGCCGGCGCCCGGCGATC
ACTTCGCGCACTCCTGAACTCAGGAGCGTCGAATAACTTCTTTCGCGAATCGAGCTTATCGATGCTTCCAAGAGAGATCGCAGTCCGTAATGGTCGAGGT
CAGGTCGTCGTCAAACTTGCTGACGGAAAGCCACGCCGCGTCGCGCGGCGCGAGATCACGTTGCCGTACACATTCGACGGCTTCCGCAGCAACGACGACT
TCCTCGTGATTGAGATGAGCTACGCGTTCGACTCCATCTTGGGCATCCCGTGGTTGTCACGATATCAGCCAGAGAT