Description :
From Genome Similarity Track
Location :
Scaffold_14:372959- 377828
Transcript NameFunction/comments
Hyaar_Emoy2802661eukaryotic initiation factor 2 beta subunit
Hyaar_Emoy2802662zinc finger protein CONSTANS
Hyaar_Emoy2802663AlNc14C71G4898

Sequence
4869 bases(100 bases per row)
AACGCACCTTATCGCCACGGTAGATGTGCCACGTCTTGATAGCATCGATCGCTTTCTTCTTGGTGCGTGGGCCACGTCGAAATGCAATCGGGATGCGCGT
CGCCATCTTTGAGTACTCGAGCTGTGCTGTCCACAAACTATGAGACCACGAGCAGCTCCGATTTCCGATTGGCTAAAATCAGGCATCTCGCTTCAGCTTT
TTCGACAGCAGACCCAATCGACGGACACAAAGAGTCAGCTGTATCTTTTGATTCGCTGAAATCTTGCAGCCACCAGACCAAACGTGTGCATTTGGAAAAA
AAGACCAGCACCACCAGCTACGCCAAAAACCAAGAGGGTCTCAGAAGATCGAGGGCATAGAACGATGGCTGACGTTGTCGAGAAGCAGGAGGTGCCTCCC
TCAGAGGAAGAGCATGTGGCTTCAGCTGCTGTGCCCGAAGACGTGGCTGCGATGTTCGATTTAAAGAAGAAGAAGAAAAAGTCCAAGAAGGTCAAAAAAG
AGGTACCCGCGAGTCTCTTTTTGTATCATCGTTATCATAATTAGCTCGATTATACGTATCTTGATCCTATTTTAGGTTTTTATTATGATTTTTGGTCCTA
ACTCTGTGACTATTTTTGTGAATACACGTTTTTTGTCCGACAATACGATACAAAATGTTAGAAAAAAGACAAGTCGGATACGACTGTGACAGACGCTGAT
GTTGTACCGGACGCCATGTCGGTGCTCGTGCAGGACCCTGCTACGTACTCGTACAAGGACGAGCTCCTGGCTCGGATCATTGCCAAGCTGCACGAGAACA
ATCCAGAGTTGACGGACCGCAAACGGCACACGATGAAGCCGCCGCAGCTCATGCGCGTGGGTACAAAGAAGACGCTGTGGGTGAACTTCCAGGAGATTTG
TCAGATGATGCACCGTAGCCCGGAGCACGTGCTGCAGTTTACACTGGCTGAGCTGGGAACAGAAGGCTCTATCGACGGCAATCAACGGCTGGTTATTCGT
GGTCGCTACGTGCCCAAGTACATTGAGTCACTGCTACGCAAGTACATCACCGAGTACGTGTCGTGCCAGATGTGCCGCTCGCCCAACACGACGCTCACGC
GTGACTCGGTCAGTCGTCTCTACTTTGTGCACTGCCAAGATTGCGGCTCGTCGCGGTCGGTGGCTGCTATTCGCTCGGGTTTCCACGCCGCTACTCGCGC
CGACAGACGGGCTGCACGCAAGTAAGATTCTCGCTGAGAACCTGCAGTCGCAGTCGCAGTTGCTTGGGACATTGCACAGGGCGACTGAGCAGTGTTCAGC
GAATGAGGATCGGACAGGATAGAGCAACAACTGGACACTCGAGCACTAGGCTTTTTTGCAGCACAGCTGCTCTCGTTGGCTTCGGACTGTACGTGAAGCT
TAACAACCTGAATAGCGCGAGGGACTAACACGGAGGAAGAGAAATCTATTATAGCTATTCAGATGTCACTACAGGCTGCCACGTCTTGTTTTTCCACAGT
TTTCTTTAGCCATGATACCTCGTTCTTGCTTAGTGGCGGTTGTGATTGCTCTTCTTGGTCCTGGATCGATTGCCAGAGTCCACAGCGTGTCGCTTCGCAC
ATTGGCGCGAGATAATGATGTGACGCTCGAGCCCGGACCCAGTGCTTTCGTGTGCAAGCCCAAGGCGCTCAGCACAGTCGTGTGCAAGCAGCCGCTCAAA
GCCGTTCAAGTTGGCATTCAAGTGCAGCTCACCCGGTTCGCCTGAATCCTTGAAAGCCTCAATCTTCTTGACCAAAGTGTGCGAGCTGCCAGTTGAGATG
CCTTCCGCCTTGTTGTTTCTAACGCTGACTGGAGCACGGCGAGGAACAGGAGTACCTTTGATAGCAGGTGTAGCCCAAGAAGCTTTGTCCTCGGAGCTCG
ACGACCTGGATGATGATGCCGACGCCAGTTTCTTCCCAGCTGGCTCCGAAGCAGATGCCTTCCTCTTCTTCGTCTTCTTTTCCACTGCTTTGGTCGAAGC
CGAGTCTTTGGAGCTACCGGAAGACTCGAGAGACGATTTGTTCGTCTGAGCTGCTTCTTTCGCCCGCTTTACCACAGGTATGGACGGAGATTCATTGTCA
GAATCGCTTTCAGATTCAGAAGATATATCCGCCAAAGCTGGCTGACGAGCTTTTGTGAGCTTTGTAGAAGACTTGGAATGAGCATTGCCATCTTCAGACG
TAGGCGATGCGGCTTCTTCTGGCGACGAGGCAGATGCCCGAGTCAGCTCGGATGATACATCGTCGGGGCTATCAGAATCCGACGATAACTCCACCTTTCG
AACCGACGCAGGCAAAGCGCGGACCTTGGTGGTAGATTTGTCCTTACCAGTTCCGGAACCCGACGACCGAGACGATTGTGATTCGACGGCTGAAGAAGAG
GTTATCGGTGCCGAAACTGGCAGCTTGACATCATCAAAGTCCTCGTCAGATTCCGTTTCGATTGAAGTAACGGTAGTCGTTAAATGGCTATTTCCGGGCT
GCACAGCCAAGGGCTCGTCCATCTCTTCATCTTCCGACGAGTCCGAGTCACTAGAAAACTCGAGTTGCGGTACACTCTCGACATAAGGCACGGTGTCGAC
GAGCTTGGTTCGTGGCGCATTCTCCACCAGCTGAGCCCCCTCGTTCTCTTCCATCTCACTCTTCTCGAGTACTTTATGCTTTTGCTTTGGCACGGTCGTC
TTCGAGCTGAATTCTTTAGCGTCACTTAATAGATCAACCCGGACATGCTTCCGCAAACTTTTGAACTTGTGCACACTGGTATCACACGACACGCAGAACG
TGGATTCACATTGCTCACAGCGCACACTAGCCGTCGCTGATTCGCACTCAATACAGCGCGGCAGCTTTGGCAATAACGGAAGCTCTTTACGCTTGTGCTT
GCTCATCACGCGAGCACTGTGCACCGCCGAATTACATTCGTCACAGTACAGAGAGTCCTCACATCGTGGACATTCCCACATAGCGGTACCAGGCTTTTCA
CACTCGGCACACGTGCGGTCGTCATTCTTTTGTGAAGGTTCGAACTCGCTTTCATCACCACTACTGCTTTGGGCAACAGCTTTCGGCGGCAAAGATTCCG
GTAAAGAAGGTTCTGGTGGAGTAGACTCCATCGGCGCAGTGCCTGCCTTCGGAGTATGGATAAATCTACATGCAGAACCACGGCCACACACTCCATTTTG
GAAGAACATACAAAGCTTGGCAACCCTCCCTGTCTCCTCAGGGTGGACGTCACGTTTTGGGAAGCCTAGCACGTGGGCATATGCGCACGCCTTACCCTGT
GAGCAGAAGCCGCGTAAAAAAAAACGGCACAGCTTCTTGTCTGAAATGGCTCGGATCTCTGGTGGTACAGCACTCGCTTCTTCATCAGCCTCTACAGTTC
TCACTGCTACACGCGTCGTTGGCTTTTGCAGCCTTTTTGTTGCAACAACAGGATGTGCAGTCGGAGCAAAAGATGCATCATCCGTCACGTGGTAGTATCT
GCACAAAAACGTAGTCACCGAGCTACGTCACCTCAACTCCATTGTAACAGAGCAAACAAAAGAAGAAATACACACAATAACATACCTGCACATGTCGCCC
CTCCGACAAATCCCGCTTGCAAAGCCTCGACACGGCTCGGTCGTCTTTTGGAACGGACGCTGGGNNNNNNNNNNCGAAACCTTGAGCATTTTGCCATACA
CTACTGCTCCATTGGTCGCCTTCACTGCGTTCACAGCATGTCGCTTCTGTGCAAAGACCACATGACTACCACCAATACAAGCAAAATCAGTNNNNNNNNN
NGGCCGTGGTTCTGCATGTAGATTTATCCATACTCCGAAGGCAGGCACTGCGCCGATGGAGTCTACTCCACCAGAACCTTCTTTACCGNNNNNNNNNNAA
TAACAATAGCACGCAAGCAGCATTCACAAAGATGGCTACACTATCGTACGCCGAGTTGGTGCCATTGTGTTTCACGCGGGTGATGGGACCGTAAGTGCGG
TACATGTTCATGAGCATCGCATCTGAGACATCTGAGCCAACACCAGACAAGACGATCGTCGCTTCTTCGCCCGTGGACGGCGCTGGACGAGCGCCGGACG
TCATCATGGCTGTTACGTGCCAAAGAATGAATTGGCTGGTCAAAAATCGCTTCTTGTGGCACTAGTGCGGGGGGACTTGTCTGTCGTGCTATAGTGACAT
CTACGCCACTCTTTTGAGGGACTTTCGGGTGTCAACAAATCAATGAAAAGGTCTTGATTANNNNNNNNNNAAGTATTTGGATGATAATGATGATGACTAT
CGAGGAGGAGGAACAACCGTTGGTTGAAAATGGACAGGAAGAAACGAAGTCGAATGGGGTGCAGCACGTACATGTGGATGTTCAGGCTGAAGAGCAGGTG
AATGGCGATGAACGGGAAGATCGAAAAGCGGACGAAAGAGCTGCAGGAAGAGGTGATGAACAAGGCGTGATAGAGAATAAATGTGAGGAAGGAGAAGAAG
AGGAGTCTGAAGAGGAGGAGGAGACGCTCGTTGTGCTGGAGCTGTGCGACTTTAAGAACCATCCGCTGTTTGAAGACTACAGCTCGGCGACGCTCGAGGT
GCGTGTGTGAAAGGCCGCCGTAGCTTTCGAATACGAAAGATTGACGCGAATGTGAGAAAATGTTCTTGACTTGTGTAGGGCATTGACACGGCGACGCCGA
TGCTGAGGATCGGGGAGTACACGTTGCATGGTAAGCTCGAGGAAACCGTGGGCACGAGTTACTTCTACGACACGGACACGATGAGAGCCGCCGACAAGAC
GTACCAATTTGCAGGCCAGACTATCAAGAAGATGAAGTTTACCATCGCACCGCCAGAAGAATTCTAGAG