Description :
From Genome Similarity Track
Location :
contig_10:372955- 374729
Transcript NameFunction/comments
g2816.t1hypothetical protein AM587_10004477

Sequence
1774 bases(100 bases per row)
CGCGAAGCTGGAGACGCGTTTGTGCATAGCGGGTAGCGAATGCCCTTGGTAACAGTGTTCCCCGATTGGTCTGTAGAGTTTAGATGTTGGTGTCAAGCCT
GAGAAGACAAATGAAATGGTGAAGAACAGAGGTTTTTGCCAGGTGTCGGTGCTGTGAAGTCTCCACGGCATGCTCGTTAGACGACAGCATCGGCGGAAAA
CACGTCAACGTCCATTTATGAATTCGTTCCGACGGTCTCATGACCGACTCTACCACGAAACCTTGCTGCTTTACATGCCTCCGAGCGCTGTTCGGTCGAA
GACTACAATACGCTATACACACAAAGGCGCCCTAAAACGCTAAGAAACTATCGTGGCGTCTAGTTGCGGCGGCGGCGACGAACGCTGCACTTGTCGCTAG
TCTGGCTGGCGCCGGTCTCCGGGGCTGAAGTGACCACAGGCGAGTCCGTGGCGGGGGCCTCAGTGGTGGCCGGGGCATCCGTAGCAGGTGACGAAGGGGT
AGCTGGAGCATCCGTAGCAGGGGACGAAGGGGCATCCGTAGCAGGGGATGCAGGGGAAGAGGGGGCCTCAGTGACCGTCGGTGCGTCCGTAGCAGCCGAA
GCAGCCGAGGCATCGGTAGTCTGCTCACTAGACGAAGAGTCGGTAGCGGGCGTGGTCGAGTTCGAGGTGCCGCCGCCACCGCCACCGCCGCCCACGGCGA
ACTTGGATGTAGCGCCCGAGGAGGTAGTCTTCTCAAGAGCGGCGCAGTTGATGTACACCTGCCACGAGGCCGAGTGCAGCGCAATCCAGTAGATGGACAA
ACCCGACGAGCCGAGGCACGCGTCGCGGTCATAGGGCAACTTGGCCGGGGCGGTGGGGAAGTTCTTGGGGCAGTTGTCGTCCTGGAACACACGGGTGTCG
TCACACCACACCTCGCACGGGCCCTCGTGCGAGGCCGTGAAACCCTCACCGTCGCCGTGGCTCCACTCAACGTACGTCTTGGGCACCGGCTGTGCGGCCT
CGTCCGGGTTGGTGTAGCCGCACTCCTTGGTGAATTCCTTGTTCACAAGGACCAACTTGTCGGCCATGAACTCCTTCAGCGACGAGTATTTGCTGGCAGC
AAAGCCCTTGTTAAAGTTGGCCGTGTTGTCGGTCGGAGAGCCGCCAAAGGTGCCGGTGAAACCCGAAGTGCTGGAGTCGATCGTCCCCATGTACTGCGTC
GTGTCACCGACGAAGGTGAACTCCACCTTCGGCACCGACATGGAGCCGTGGCCCTGCACGGTAGCAGAGAGCATGGCCGAGCCCACGATCGCCGCGAAGG
AAGCTTTTCCGAGAACCATCTTTGAAAACCTGTTTGCTGTCTGAAGCTGCTGAAGGCGAGAGAGGTGTGTTGCCGTGAGCGAAATGCAAAATGGTTGATT
GTGGGGCATTCGCTGTCCGAGCATTGGGCACTTATTCCGATCCAGATTACAAAAGAGGCTCTGCAGAGTCTGCACGGGCATTAAAATCGAGCTGGGCGAA
TCGAGGCAATCATGGGATCTGCTTGACACCCGTGCTTAAGGGCAGATGGAACGATGGGGATCGCACCCTTCAGATTTGAGGCTGGCCTTATGCCACTGAT
ACCTACACACAGGACTCAACGCCGCAATCCGCTTCAACCAAGTGAAGACCTCTAAATACTAGTAATCCACCCCAAAGCGAGAATATCACTTGAAGATGCC
ATTTTAACACGGTACACAAACAATTTCTACTAAAACGGTGCTCTGTTGCTACATGTACCGAACGATACATCTAG