Description :
From Genome Similarity Track
Location :
Scaffold_69:37295- 38826
Transcript NameFunction/comments
Sapdi_VS20SDRG_14213hypothetical protein

Sequence
1531 bases(100 bases per row)
GCGCCGACGCTGGTTGATCTTTTCGCGGTGCGCTGCGAGGTACTCCTTCTTGCGCGCGAGGACCTTCTCGCGGTGGTGGACGTAATATTGCTTGGCCTGC
GCGAGCTCGCGCTCCTTGTGGCGCTGGCGGTACTCCTTGTTGAGCGCGAGGACGTTGTCCTTGTGCGACTCGTAGTAGCGGCGCGCTTGGAGGAGCTCGG
CCTCGCGGTGGCGCGCATAGTACTCCTTCTGGCGCGCCAGGACCTTTTGGCGGTTCTTCTCATAGTACTTGCGGTCGGCCGCGGCTCGGTTGCGCTTGCG
GGTCTCGGACGTCATGCTTTTTGAAATGTGGGTTTGGGGTTGCGGGTGAAAACTGAAGTGAGACGGCGACGACGCCGATGGTGTCAAGACCGTAGCAGTT
GCGTCCAGAAGTTTGCCCGTCAACGAAGGGTTGGATCAAGCGCTGGGGCCAGCGCGCGTACTTCCTACAATGTACACGGTACCCATCCCTCGAGTCTTGT
GTTTTTATGCACCTTTCTCTTGTCGTTTGTAGGCGCCTTTGCGATTTTTGAAAAAAACACGATCCATGGTCACAGCAAGCAGATGGTTTCGGCCCGCGAC
GTCGACGCCATCGCGCGGCAAGGGCCCTAGGAAATGTAAAGTTGCACACGCCATTACGATAGAGGCGCTTCGGGCGAAGCGATCGAAGGGCTAGAACGCC
GTAGGAAGAGCACCGAGAGCCGCTAGACGGACGACGAAGGGGCATTGAAGCGCGCGGCCGCGCCTAATTTTTCGGCCCAATCTAAGCCGTGTCACATGGG
ACAAAGCGACTTGACCCGTGTGTCAAGAGAACAAAGAAAAAAAGATCCAAGTGACGCGTGATACACCCTACGGTATGACCCAAGAGGGGGACTGGACCAA
ACTTCAGGATGTAGCCATTGACGGACTTGGCGACACGTGCACAATGTGCTGCTTGTGCAAGGTGGCGCACCACGCCGAGTCGGATCGAGCCCCACGGACA
AGGGATGTGGGGTCGCATCCGCATTGGCCGGTGCGATCAACCTCCTCAAGAGCAGCCTGTTTCCAAGTTCAAACATCGCGGCCCGAAAGGCAAGTAGCAA
CGCCGGCCAAGCAGAGGATCGGCCGCTCGGTCCCGGAAACTTCAGGTTTCAAGCAGCTGAGTGCGACACGAAGAAAGATCCTTCCACTTTCCGGCGCGAT
TTCAGCACGTATTATACGCTGCCGTGGCGGGCACAGAAGTTGAAGCCAGCATGCCACATCATCCGTGGCCAGCCAAAACACAGCAACCAAAGGTCCCATG
AAAGAAGGGGAGAACCACGCACGCAAAATGATCCCACGCTCGAGTAGCTCGATCTGCCAGAGACCGTTTCCTTGGCGCCAGCAGCAAGTCGAACCGACAC
CGTCGTCCATCTCAACGAGTAGTGTGATGGCCACTGATACATGCTGCGCAGATGCCAACCATGTTCATGGGTGGTGCGCGCAGCCGTGCCTGATACGCTC
GAAAATTTAGCCGGGAAGCCATTCTGGAAGC