Description :
From Genome Similarity Track
Location :
Scaffold_1365:3729- 5021
Sequence
1292 bases(100 bases per row)
TCGAGGGCTTTACTTGGAGCCATACGTTTGCGCTTTGCAGTGTAAATTACGCCAAGTCAACTAAAGAGACGCTCGCGTATGTGGCAGTATTTACTGCAAT
AAAGAGCACCCTCATGGCGAGTGTTGGAAGCTGGCCCTTGGGACGTTCCGTCGCAACGCACTCCCAGTACTCCCATGGTACATTGGGAAGCTCGCTAGGC
TTCGTTCGGGTAAAGCGACCTTTCATCCAGGCCAGCATATCACGTCGTATCTCACCAATATCCTCAGTAGCAAGCAGTCGCCGGAATTAGTAAACAGCAA
TCTTACACAACGTGCCGGTTCCCGATACAGCGGTCTCCGGTAACGCTCGGGCGTTCTCCGCGTACATTAGATGTAGTGCAAATCCAAGCATAAACAGGGG
CTGCTCACACTGCCCAACGATGCTCAACGCACTCAACTAGTTTGCTACGACGGACAAGATGTTGCTGGAAACCTTCAAAAATTTCCCGAAAAAATGGTTA
CACGACATCTCCCAGGGTATTCTCATCTCGCTGAAGACGAAACGACGCGTAAGATATTGGCGCGATAACGGTTTCCGCTTCTTTTAGCTCTTCCCAAAAT
AGAGACTCGCCAAAAACACGCAACTGACTTGGAAAGTCACTTTTTGTTTTGTATTGGCGGTACAGCGTTTGCAGAGTTGATTGAACGCGAAGCAAAGATG
CCAAGCATCCTTGCATAGAGTTCCACCTTGTTTAGCATAGCGTCCGTAACCCCAAAATTCTTCCGTAAGACTTTTTCATGATTTTTTTAGCACGTGGTAG
CCACTCGAAGATGACGCGCTTAAAAGGTTGACGGTCGTTGCAGCCTTGGATGCAACACCATTAAAATTCGATTTTAGTACTGCTTTCACGAGGTTGTTGA
CGTCATGCGCAAACAAAACAAGAAGACAACCTGCGGCTACCGAATGGCCAGAATCCGGCGTGCACGTCCACACTGTCCTGCATTATCCGTCGCCATTGCT
CCAACACACCACCCTCCTAGTTGCGCTTGCTCCAGTAATTGCTCAAGTTGTTTGGCAATAGCTATGCCATGATGCTCGTCCCCAGCTGGTAAGAGCGCGT
AGGTAAGCAGTATTCCAAAGAGAGAGACAGCCCAATTAAGAGTGCCTTGAAAATATCTTGCCAAACGTCTGAGAGAAGATTAATCCAACCGTTTGTAGCC
TTCACCATTGCCCTCAAAGCTTCCGTGTCCGTCGTTTTGCAACGGCTTGCATGCTCTTTAAGGATGCGACCACTCAACGTTCGTCGAGAAGG