Description :
From Genome Similarity Track
Location :
Scaffold_11:37288- 42416
Transcript NameFunction/comments
Phymu_g843pyruvate dehydrogenase E1 component subunit alpha
Phymu_g844hypothetical protein PHYSODRAFT_554387

Sequence
5128 bases(100 bases per row)
GTGGCGTCTATGCGGATCGCCATACAAAGAGCAAGTTATTTTGATCTTCccatcgtcgctgcaggCTCAGATCGTCGACGCGGCGGTGTCGGCGCAACCA
GCATTCCAtcgccgcagcagcaacacttcCTGCCCTTCCTGtgccttctccttcttcgcttctCTTTCCTTTACTCAAAGCAACCGCTTGAGACAAGCAT
TTACATGCTAAGCGGCGTCAAGGCTCGATGCCGCACGAAAAGCTTCATCCATCATCTCGATATGAGTGCACGTAGTGGATGATTTGATCCGACGTCATTG
GTCGAGAAGAAGGGGAATTCGTACTTACTCGAGTTTACGGCGGGCACCGAACGCTGCTTGGACTCACTCTCCAATCCTCCTCCAAGCACCCTTCAGGTCC
GAACGTTTAAGGATGATGATGCTTCGCCGCTCGACCGCCGCGCTGGCCCGCAACGCCGCGCCAGCCACGCGCACCTtcagcgccgccgccaacgcCTCGG
GGGAGGCCAAgttcgacttctccactcCCTTCGAGCTGCACCGTACGTCATGTGCAACGGATCTTCTGTTGCTGATTGGAATCTAAcgcagagtgatggt
cataTGACTTTTATCATGCGCAGGTCTCGAGGAGGGCCCGGCCGAGTTCGCCGTGACCAACCGCGAGGAGATGCTGGGCTACTACAAGCTCATGTACACG
ATGCGTCGTATGGAGATCACTAACGACAACGAGTACAAGGCCCGTACCATCCGCGGTTTTTGCCACCTGTACGACGGCCAGGAGGCCGTTGCCACTGGTG
TCGAGGCCGCCCTGGACCGCAAGGACTCGTGGATTACCTCGTACCGTAACCACTGCATCATGCTCGCCCGTGGTGCCGAGGTCAAGGACGTCCTGGCCGA
GCTGTTCGGCATGTCTACCGGCGCTACCGGCGGTAAGGGTGGATCCATGCACTTCtacaacaagaaggagaacttCTACGGTGGACAGGGCATTGTCGGC
GCCCAGGTGCCCGTGGGCGCGGGCCTGGCCTTTGCCAGCAAGTACAACCACAACGGCGAGGGCCTTATGCCGTGCGCCATCACCATGTTCGGTGACGGTG
CCTCTAACCAGGGCCAGGTCTTCGAGGCCGCCAACATGGCGGCCCTGTGGAAGCTCCCCGTGATCTTCTGCATCGAGAACAACCACTACGGCATGGGCAC
GTCCGCCCAGCGTTCGTCCAACAACACGGACTACTACACCATGGGCAACAAGATCCCGGGTATTAAGTGCGACGGTAACGACGTGCTTGCTGTGCGCGAG
TGCACCAAGTTCCTGAAGAACTGGTGCGGATCGGGCAATGGCCCGATCTTCGTCGAGATGAACACGTACCGTTACCACGGTCACTCGATGTCGGACCCTG
GTGTGACGTACCGTAACCGTGACGAGATTTCGCAGATGCGTGCCTCGCGCGACCCCATTGAgatggtgaagaagcgcatgaTTGAGTCTGAGCTCGCCAC
GGCtgacgagatcaaggagatggagaagaaggtgcgtGCTGAGGTGGTCAAGGCCACCAAGGAGGCCAAGGCTTCGGGCAAGCCCGAGGAGTCCAAGGCT
TTCATTGACGTGTACTCTGACGGCAAGGGAAACAACGAGTACCCGCCTTTCATCCGTTTCCCTGACTACGCCAAGAGCCTGTACAACGGCAAGCCCCAGC
AGTAAGCTCTTAGTGCAGTGTGGAGGTTGCAGAAGCGGCGAGAGGATCATAGCCCCTCTTCAGGACAAAGCGCCTCGACAAGCGGTAGAAGCTGCGCTGC
GTCGCCCTGTATTTCCTCTCTATTTCGGCTCGCTGTAAGCATGGTGTTGATTGCGCTGTGCAGTGCATCAGAACCCGGCTGGCATTGAAGCTTATCTCTA
GAACCAGTCTCGTAAGCTTTGCGACCCCATTAATACCGGCTGAATATGTAAACGCCCATCGTGACCACAATTGCACAAGTTACAGTTCTGATGCTCCGCG
TGAATATGCATAGAGCTTGGTCACTAAATGCGCATTGGCACGAGTGCGTGGCATCATGCCAATGGCGTTGCCATGGCAACACCGCAAATCGTGTCTTGAG
TTTTGACATAGACCGTGTTCAAGCAGCGTTGCACCCTGAAAAAGTCCTTTTGACCCCAAGCAGaattgaagttgctggagcgtGTTTCTTTGGGGTCGTG
AGTTCGCGTGCCAACGGAGGAGACTTCAACTCGGAACATCTAGTGCTACAAAGCTGCTCAATTCCCATGTTAAGCTTACTGATACTACGATACTAATCAT
GCAAGTTCACTTCGAGCTGTGGTTCCCTGCGTCGCCTCTGTCTCACGCGTGTGTACatgcttctcgtccacatACTGACTCACATCTGCACTTGTTGCGG
CCGTGCAATATTTTTCTACACTACTTCACCACTTAACTAGTTCACGGTCGGCCGCAAGTTGCATCTTGATACTTGGGTTTTCGTTGCCGTCGTCATATTT
CTTCCAACAGGTTGGAGCGGACAGCGCCTTTGCTCACATGTCAGTTCGAGTACAGCACGGTCCCCGCACCCTGTGCCACCTCGAAATCGCTTCCGTGGCG
GCGGTGCCGCGGTCGACGACGCACCATCGGACtattgttgttgttattGCCCTTGTCGCCACCATCGCGAAGCATGGGCGCCATGAATTcgtgctcctgc
tgcagcgccaccacgcGGAAGTGTGACAGCTTTCGAGCTTGTTGCGCCAAACTGTTCGCGTAATTGGCAGCCATAATGATGTCCTTGGAGCGGGCCATCG
CCTCATTGAactcgaacttctcctcgccgtcaCCCACTGGCGATTCCTGGTTGTTCTCGGGGTTGACTTGGATGCGTAAGCGACCAGGGAGAAGACTCGG
AGGTGACGCGCGCCTGTGCAGGGGCGACGCTCTTGTGATCGAATACGTGGGCGAcacggacgaagacgacgcggtCGATTCGTCATCCGTGTTGTCATTC
TCGTCCAGAGCGTCCTCGGGTTGCTGCCCTGCGTTGCCCATGCGCATTTGGCGCAGGCGGAAGGCCTCGATCGAGATAGCCAGGTCTGCGGGACTGCCAC
GGCGCTTAGCTGCGAAGAGCGCCCTGTTACGCATGACGAGGCCATCGCTGAAAGAACGGCTCGGAAAGCTTGCCTTGGGCACACCGATAGCTGAACCTGT
GGAGTCGAAGCCGTGCACCTCCTCATTACCAGACGAGAACGTCTTGTACTCGATGAGTCGGGAGCGGACAGGGTCTAGAAGGTCGTCGTACGACCGGCGC
TTTGGGGCCGTTGGTCGGTTTGGTTCATTTTTAGTGACTGAAAAACTCTTTGCTCGGCCGAGAATGGGGGAGTTTTCGTTCGAGTCGGAGAAGAActggt
tgctggtggtggagctaAGCGACGAAGTGTTTGTGTTTGGCGAGTCCTTGCCGCTGGCAGTGTTGCGTGAAGACTGGCGCGCTTGGATGACGCATGCCGT
GCAGACGCGAAGCTGGCGCTCGCCGATATCCGGCACGTGTGCGCTGCGCACCGAACTGCATGAGCTGCAACACACCTCGCCACATTTGAGGCAGTTGTAG
CGGCGACGACGTACACAAAACCTCTTGGCGCAGATCTTGCAGTGGTCCTGCTCGCTCATGGGGACGACTTGTTGGGGAAGAACAATCTCCTCGCGACCTA
CGCGGAAGCTTTCCGTGTACTTGAGGATGCCGTTGATGCACTTTTCCACGTGCGACTGAATGGCCGAGTTGGCTATAAAAGCAGGGAGGTCGCCGTTGTC
GAAGTTGCACGTGTACGTCATGCGTAGCTCACCCGAGCGCTTCGTCGAGTGATACATAAAGCCGATCAGCGGAACGAGGTCGCGCTTGAACTTGGGCGAC
TCGGCGTACTTTTCGAATCCCGTGGGTGCGTCCACGGATTCCATGATGCGGAAGGCAGTCATCTGTCCTTGTGCGTCCTCAATCATGTCGACGTACTCGA
GCATGAGCAGGTCGCGATCCTTGGCGAATGTGCCTGAGCTCTTGAAGGCGGCCCACTTGAGAGCGACGTAGCGGTGCGGGTTCGTCGGCGTGGGCTCCAC
GATGTTCTGCACCACTGCACCATCCAGGAAATCCGACGACAGCATGGCCATCATCCGCTTGaacgacgccgtcgtcggCGTAATGAGCGACGCCGCGACG
TCTTCGATGCTGCAGGCGAACTTGCACACGGCGTGAACGTTGCAGGGTACGTTGGTGCCGCTGTTAGCGGCGTCGGCGCGAAAGAGCGAGATGCCGTGCT
TTTCGTGCACCAACCCCCATGGAATCCCACCGAGCAGGTCGGTAGCTTCCAGGAGACTCTCTGTCATGCGCTTGGCCACCGTCGTGAGgcgctcgcgctc
cttcACGCACATTTGCGAGGCTACTTCGACAGGATCGGCATCGCTGTCGTCGGTGCAGTCCGACCCGTTCGAGGAGccgaagctggagagcgagcgaGGA
GTCAACGGGGTCCCTGTCAGCGGCGACCCGGTCGCAGGGCTGTAGTCTGTCATAATATCTGTATGTAATCGAGCGCTGCTTAATCGTCCAGGGAAAACGA
GGGGGCCTGAAAAAGCGACGTTTGCCTCAAGACTCAAATGCGAAACTGAGCGATTTTCGGCCGAAGCAGGATGGGGCGCTCACCGTTTCTCGTCGCACGT
AACAGCCCAGTCAGGACGTACGTGCGGTCGTCTGAACTCTATTTAGCGCGAACGGCTAGTGAGCAGTGGCAAGTTCCCTTCTATTTTGTCCCTGACGTAC
CTGGTGCGAGCACACAGTATCCGCTTGCTTTCCGCTAGTATTTGATTTTCTGGGAGCCATATACTCGATGCTAGGACAGGCCATGGCGACGATGGCCAAG
AGCTGATTTcgaacgtcgtcgctggaCGCACAGTCAAGTCAAAGCGAGCTCGATGGTACCATCAAGGCAGCGGAGTGTACTAAGTGCTGGATCTACTAAG
TGCTGCTCACTCTAACGCTCCGAGCATCCGATTGGCCGgtacacttcaacttgccgcTGTTCAGTGCCCACTCATCGACGATAACGCCCCGAACGCCTAC
CGAAGGATAGAAGATAGTCGCCAGAAGC