Description :
From Genome Similarity Track
Location :
scaffold_66:37287- 47977
Transcript NameFunction/comments
Pl_110630hypothetical protein PHYSODRAFT_468736
Pl_110631conserved hypothetical protein
Pl_110632conserved hypothetical protein
Pl_110633conserved hypothetical protein

Sequence
10690 bases(100 bases per row)
TCCGGCGACGACTGGAACCACGCTCCGCACTCCGACTCCGACTTCGTCTCGACGAGCGACGTTTGTGCGACTTTCGCTCCTTTCGGTCTTTTTTGTCCTT
CTTCCTCTTCTTGTCCTCGTCGCGCGACGAGCGGTGCTTATGTTTCTTGTGCTTTTTGTGCTTCTGCCTCTCTTCTTTCGCCTGTCGTTTAGCATCACGA
CTAAAGGAGTTATCAACACTACGGGATCGTTTTCTGCTCCGGGCACCGTCATCGTTACCGCTTCCAGTAACGTTAAAATTGTCGACATCCTCATCGGATG
AACTCGAGTCTTCTGAGCTGACTTGGAGTTGACCAGCACTTTCACTCTTCCTTTCCAGAAGTAAGCTAGGAAGTTGTCTCTGAACCTTGTCTTCGTCACG
CACTCCATTGTGCCCTTCATTGTTGTCGTCCACGTCACTTTCGCCATCACTGTCATCTTCGCTCACTTCTGATTCGTCAGATGGTTCAAAAATGGATTTG
AGCAAACTGGTTGAAGCCTTTTCAACTGCTGGAAGTGGAGGCAGCTCCGTATCCCCAGCAGGTTTGATTTCAACAGCTTTGAAATTTGAATTCACACGCG
TGTTGTCCTCCGTTTGTCGGTGAGCGGCTCGGTCAGCAGCGAACTCCACCAAATGTGGAACAAGTTCCTCATCAAACAAGTCTCGTTTCTTGTCGTTTTC
GTCATTCTTGCCGTTCGAACCTGTTGGGCCGGCACATTTTACGTGAAAACGCTTGCAAAGTAGTGATTTGGGAATCCACAAACTCTGAGATCGATGTGAT
ACTTTGACTTGAGGTTCCTTTTTCTGAGCAGACTCATTATTTCCCTCGTCCATTGTGGTTGAAGGCACGAATCTCTTTGCAATGGATGCAGAGATTGTTG
CTCGAAACTGATCACCATCACTACCTCGGACTAATGGTTGTCGCGTTTTGGGTGTTGCTGGCTCTTCGATAGTCGTAGAATTTACTTGGCGGGTCAGGGG
AAGACCCTGCTTTACTTGCGCTACAGCATCGAACAGTTTCGTTCTTTGCTTTTCACCAAGTAAATCAAAGACACTGCTTCCACACGCGTTCTTGTCTTCA
CCAGCAGCTGTCGCGACGTTGTCTCCGTTGCCTTCTGTACATAGACTTTTGTCGCCCAGTAAATCACCTCTTTGCTTCGCTGTCACAACCGCTTCACTCG
TGGCATTGTCTGCGAAGAAATTAAACTTGCGATACAAGGCTGTGACAGCATCACACTGGTCTGCATCTTCATCAAAGTGATGATACGGCTTAAATTCTGA
AGGCACAGCAAGTTGCAAGTTAACTGCCTTTGGCGTCTTATCCATGGACGTAGCCAGCTCGAAACCAGGAAGCACAGGCCGACCGTCTGAGCACAACGCT
CGACTGCGGCTCGCCTTCTCGTGCCGGCGCGATTCTTGAGCCGACGAATCTAGTCGCTTGACATCCTTCCTCGCTCCAAGTGGAGCTATCACTCGATCAA
ATTCAGTCATCGAAACCGCACCGTACACATCAATGTCGTCGTTCTCTTCCAACGCACTCAAACCATATCCACTCGTCACACGATTACTACCATTTGTAGT
CTTCAACGCATCCAAAAACGACACCACTTGACGATGAGAACCTTCCTTCTCTTTCTGTTTCTTCTCCTGCTGTTGTTTGTATATCGAGAATTCTGGAGCA
TCCGTGTAGGGGTCAAAACCTGCTCCGTATCGATCCAACTTTGGTTTAGGAAACGCTTTCTGCACGTCAAACACATTTCGTGGTGGTATATACACGTCCT
CATCTGGTTCTGTTCCTTGTTCTACATTCTCCACTTCTCCCTTTTCTTCTTGAATAAATTTGCGTCTTCGAATCCGTTGTCCGATTCCATGTCCTTCTTT
CCAGCCCATTTGTTTGAGTAGTGTAGCTCCAATGGAGTCATTAACCGGTAAGACCCAGTCCTCAGGCAGTTTGAACCCTGGAATTGCAGCAGCTTGCGCT
TGATCTGGTTGTTGCAGTCTTCGCTTCGCTGCTGTCTGCAGTGTATCATAGCGTTCTGTGGTTTCCAGTCGTTTTCCCAGCAGCGGATCGTCTTCCTCGT
CCATAAAATCCTCAGGACGCTGCTCAATGTGCGACGAGCGATTGCCACGAGAAGACGAGAAGGTTCGTGGTGTCCATCCTTCCTCACTGCCCACAGAATT
GTAATAACCAGCCGAGAAGCCGCCAGTGAAGGCTCCGTGGAAATGTCGACGGCCTTGTGCGTCCGTCACCTGCAGGATTTTAACGGGAAAAAGGTATATA
TGTTAGCAGATGAGGTGTAATTAGTTGTGGCCTGTAAGTAGATTACGAATCGAGACGAGAGAAGAGAGAGAAGAAGACGTACCTCTTGGCTGCGGACTCC
GCGTTTCATTGAGAGAGCGTTCCAAATTATGTGGGATGTTCACATTATTTGGAACGTAGAGTGTAGCCATTGTATAGATGGCTACACTTTAGATGACTCG
AGTTTTTTTGCTGTCTCTTTGTGAATCTTGTAGACGAGCAAACGTACGTAGAAACAGTAAGAAGAGCCATGGACTTGAGACTTGAAAGTTGAATATGACA
GTCCCTTTTGAATTATGAATATGCATGCTAGTGAAAAACTGCACAAAACTGTAGCTAGGCAGCCATGACGCCGGATTGAGGTGGGCTGGAATGCGATGTG
CACAGCGGACAAGTTAGCGACTCGTTGAGTTTCGCGAGGATACACTCGTCGTGGAAGCAATGACCACAGTTCAGAGTAGTCAACCCCGCCGTCACGTGCT
TGTCGACCTTGTCAATGCTGGAACGACCACGTTTGCTGCTTGGTGCAGCTGGTACGATCGACACCGTATCGTCGCCGACGAGCGCCTTGCGACAGATAGA
ACACTCCTCCGGATCTTGTGTCGGATCGTTGTCCAGGAAGCTGCTATCTCGTCCGGCCATCGACACTCGTTCGCTCAACCTCGTGAAGTCCGAGCGATCA
AAGACCATGCCTTCAAACAAAAAGTCGTAAATGAGTTGCGGTAGCTTCGTAGACGACACTGCACACTCGAGATTACGATTTTGCTTGGCCATACGTAGCA
GCGTTGAGAAGTATGTCTGCAATTGAGAGAGACGAGCTGAAATGACACTGGGACTTCTCGATCGGAAGATGTGACGGCGTGGGAAGTGATGTGCCGCGTA
CATGTAGAGCCACGGACAGTTTGAGGGACAGAAGTGGCCGTAGTCGAGCACCTTGGCAATTGCTTCTTTGAGTTCGTAGAATTCCTTAAATGTCCTCGCC
ATCTCCCACGTTTGGTCTAATGCTGTGTTGCTGATGCGCATAATGTAGCGCGGACTCGCCAACTTGTTTTGACCAGGCACTACAGCCTTGATGAATTCCA
CGTGGACATTGTCCAGTAGTGTTTGTTCAAAGGAGTGCGTCTGTGTGAGTGTAGTCGCTCGATTCCTATCCGAACGGCGCTTGGGGAACGAGAAGGAGCG
ACTCATTTGCTGGTCCTGTAGAGACTTGCGACGTCGGAGCTTGTTGGATGGTGCGATGGGCAGCGAAATGGACTTCCTTAGTGCCATTGTCAGCTACAGA
GCTGGTACCAGATGAACTGATAGGCGAAAGGCGTGCAATGGCGGTAGCGCAGCGCTGAACACCCAAATACTTGCAACGGTGTGCCACCTGGAGGCAATTG
GCAAATGTGAGTGCTCCAGCTGGCGAGTCCATTTGCACGTGTGTACGATGTGGAGGCATCCCAGCTGTATCCATTCGAATGGATAACGACATACTGGATA
GTGACTAATTTAAGGAAAGTACGGTAAACTGGAATAGAGTAAGCAATTAATGGATACGTTCGTATTGGAAAGTCTCCAATGTGTCAGTAAGGTTGTTATA
GTAAGGGATACATAGCTAGCTTTTGTAAGTCGCTGACGGTTGTTCGACGTCGAGCGAAGCTGACCACGTCGAGCAGTCGTGCGTGCACTGTTAACGGCGC
TATCAATTCTGGCGACCTGGATACTTTCACATTGCGGCGATGACCTCGCAAGCAACGAGCCTCTGCCATTGGGAAAGGATTCGAACGGGACGATCTGCAG
GCTACACCGATCATCACGTTCGAATCATTTTAACAGTTCGGAAAACTCGGTTGATTATGGCAGTCAGTTCAGTGTGGAGAATCGCGTGATGAATTCAACC
GCACGCCTCGCGCCGACAGGCACATTGGATTTGTGGATTAGTGTGACTGAGTGTTAGATAAATGCACGATTCCCGCAACTTACCGTTCTGATATATCCGA
TGCAAGTCAAAACTGGTTTGGGCTTTTTCGACAATAATCCTGGTATCCGTTGGGCATATCGGATACGCAAACTCATCACAACCCTGGACTCAATCTGAAG
CGCGGGAGAGTAGAAAACGAGTCACGCGTTGTTCTTCATGCATTCACATCTTCGTTGGTAATTGTACCTGACAAAGGTGCAACCCACGTGCATCAAACAC
AATACCAACTTGCTTGCTTTACTACTGGTACCCAACATCAGATAGTGCCAACCGAATTCGTGTATTTATTAACTCGACAAAATCAGCATAATCCAGACGG
ACGTGCGCTGTTTTCATACCTGACTCACATTGCCGTATAGTCCGTCTCGAAAGCGCCACCTGTGTCGCTGAGATCTGCAAACAAGTTCTCTTCCCGCTGA
CGGGCGAGCGCTTTTTGCCTGAAGAGCACTGCGGCAACAATGACAGCCACGAAGATAACACACCCAATGACAATACCTGCGATGGCTCCTGCGCTTAAGG
CACTACCAGCCGAGCCAGTGCCACTATCACCACTAGTTCCAGCTCCAGTATTTGCATCTATGACCGTAGTCGTCCCTGCATTTGCATCTGAAGTGTAACC
AGGAGACACATTCGTCGACGTTGTAGTTGTCGTCGTGTTTCCAGTCGAAGCTGTTCCACTGTTTCCCGTTGTCGTTCCAGTTATTGAAGAACTAGACGTC
CCAGATTGGTCACCGTACGGCTGTGTAGGAGCAGGAGTCGAGCTGACCACGCAGCCATACACACCAGTGTCGAGAAGCGCGCAGTACGTGCCACCAGGAC
AGTCGCCATTGCTCACCTGGGCCCTGCACACGTTGTCCGAGTCGATGCAGCCGTCGTGGTCCCAACCGACAACACCGATCGAGTGTTCATTGCTAGAACA
GCGGTCGCCGTCCTTGCATCCGTACACACCCGTCTCGAGCCAAGCACAGTGAGCACCACTCGGACAATCGCCGTAGATGTTGGCAACGCACACGTGACCC
GAGTTGACGCATCCGTCGTGGTCCCATCCCGCCACGCCGATACTCTGTTGGCCATTGGGGCATGAATGTCCAGGTGGCTGTTCACCGTACGGCTGTGTAG
GAGCAGGAGTCGAGCTGGCCACGCAGCCATACACACCAGTGTCGAGAAGCGCGCAGTACGTGCCACCAGGACAGTCGCCATTGCTCACCTGGGCCCTGCA
CACGTTGTCCGAGTCGATGCAGCCGTCGTGGTCCCAACCGACAACACCGATCGAGTGTTCATTGCTAGAACAGCGGTCGCCGTCCTTGCATCCGTACACA
CCCGTCTCGAGCCAAGCACAGTGAGCACCACTCGGACAATCGCCGTAGATGTTGGCAACGCACACGTGACCCGAGTTGACGCATCCGTCGTGGTCCCATC
CCGCCACGCCGATACTCTGTTGGCCATTGGTGCATACAGCTTCCGTATCTGTGGTCTCTTCGTTGCACTCGTAGCTTTCTCCGTAGTCTGTGGTAACTTT
TGTGCAGTGTACTTCGGGTCTGTCTGTCTTGGATGATTTTTCTGTGGAGTCGTCACTGCACTCGTAACTTTCTCCATATGTGGTGGTAACTTTAACACAG
TGTGTGTACTCTCCGTGTTTCTCGTCGTCGTTCGAACTTTCCGTTGCTTCCTGTGCATCCCTTGTAAGGTCGTCCCAAGAATCATATTCGTCGTTCACTG
TCGGAAGGTGCTCATCGTAGTTAGGGTTGCTAGAATATATCTGTTCCTGTTCGTCTTGATCTTTGTACGGCGTTTCATCTGTATTCGACAGTATTTTTTC
TTTGATGTCTTCCCAAGAATCGTTTTCGTCAATCACTGTGGTCAAGTGCTCCTCATAGTCATCGTCACTGTGAGGGTAGATTGGAGGGAGAGTTGGTAAT
TGAGTTGGCACTTCACACGGACTACAGTCGTGTTCACCCCAACGCACATACTCTTCACTGACAGTCGTCGTTTTCATTTCACCCTCCTCAGTTTCATGTA
GATTAGGCTGCACAGGTTCCTCCGGACTCGACTCTTCTCCAATTAGTGGAACGTGCTCATCCAGGATATTGTCAGAAGCATCTACTGTTGGTCCCGGATC
CTCTTCCACTAGCTTGTGCGCTCTTAAGTTGACTTGGTCATGTAGGTCATGTGTTGCAGAATCCCAGGGGACGACAGGATCTAAGACAGCATCGTACACT
GGCACTGTCTCGTCAGCACTAAAGCTCGTCACGTCAGTTTCAGGATTCACTTTCGTGTTGGAGTTTGGCGACTTGGAAGCTCTGTATTCCCATGGAACAA
TGACATTTTGCACCTGTCCTTGGTGTTTTTCTCTTGAAAAATTGTCCGTTCTAGAATTCACCACAGGAATTTTGTCATCGTTTATTGGTGAGCTTGACTT
CTCGGTCACGGTTCCTCGAAGCAATCCGATCCTGTCATTGATTTCTTGTTGAAAGAGGCTTTCCTTCGTGTCTTTGGGCTGCTCTGTATTCTGCTTCACC
TCAGACTTGGTATGGATACCCGTTACAATATCGCCAATGCTGCGACTAACGACTGGATCAACTTCGGCCGTAGCCTTCGCAGTGAGCAGCGTCGTCGCCA
CCACCCAGCCAAGGTATCGCCTCATAAAGAGCCTTGTCGTTGATGGACAATGGTGCTGTGTACCTCAAGCTGTGATGCAAGCCTTCCAAGCCGAGTGCAA
ATGTTGGATCCACGAAATGATACCATGCTAGGTCCTGTGCGATCCTACCAACGGTCGATGAATCTTTGACGTGAAGGGTCAGGAGACTGGTCCAGTCGAC
CCCACACGTTGCGGAGTTGGCAACTCCATAGTAAATCTAGAACCACCAGGTTTGCTGCCTCCTGCTCCTCCAAATCTCATCTTCATAGACATTGGACTCG
ATCTAGTGGCACCGTATTGATGTAATTCCCAGAGGGAAGTTGACAGCTGAAATGAATGATTTCGAATGATGCCTTTTCCTCGCTGTTCTGCCCCAGCTCC
CTACACTGTGAGACCCATGATCTTGCTCGCGTATGACGAGAAGGAGCGCTTCATGTAGCTCAAATCGCTGCAAATTGTGTCCATCGTGACGTCCACAAGC
ACCAACTTGGAGAACTTCTCGAGTTACTTTGGACTCTACCTTAAGTTAATAATAGGCAGCGTAGTGCCAGCAGCAGCATCTCAAGCTGTAGTTCTAAATC
CAAGGACTGCGGTATCGCATGCAATGTGGATTTTCATGCAGGAGTTTGTAGAGGTGCTCTATGATGCGACAGAACCGTCAAGTCTCGGAAAACACGCAAC
TTTGCCGTGCCAACTCTGCACATTTGCCTCTCGATTAAGTCGCGTCAAGTTTCCCCTCTTATACTCTATCCCTGTCTAAAGAGTTACTCACACACCCTTT
TACATTGTGCGTGTTGTATTACATATTTACGTAGAAACACATGCCCTGTGATAGCAGATTTAATGGCGTCATCACCCCTTTCGAGAGATGTTGCTCCTGT
AAGGTATTATACAGCATTAAACCATTAACTGTAGTAGCTTATCGTAATAAAAGGATAACAAAATAAAATAAAGTATAAAATTAAGTAAGGTATTATGTAT
TATAAAATAAGTACAAACAGGTTCATGCCTCTCACCTTCATGGCGCAAAAAAGNNNNNNNNNNGAAACGACCAAGTCAGACACGACTCCCATCACTAGCA
CAGTCACTCGAGAAACTCCCTCACTCCATCAACTTCTTCATTCCAGACCAAGTACACTATGAACTACCTATTCGGCTACGGAGAAACACCAGCAACGGAG
GAGCAGGTCAAGCCCGAAGAACCGTCGTACCCCACCGCCGACGATGTGGACTTCGAAGCTTTCGGCAAGGAGAGCATCCAAATTCTGCTGAATCGCCACA
CTGGCGACGACAAAGTGACTACGTGGGAGGTCGTGGACGACGCCAATGACGTCAACATCTGGCGCGGTGCAGTGGAGGAGTGTGACTGGTGCCCGTTCCG
TGCTGCAGGCCGCATCGACGCCGACAAGCGCGTGATTGAGCAAGTTCTGCTGGACCCCAACCGCACATTGGAACTGGACGAGATGATGGAGGGCATCGTG
ACTCTACGTGACGTTGGCGAGGCCAACCGCTTGGCTTTGCGTCAGATTACTAGCAAGGGACAGTTCCCCATCTACGGCCGTGAGTTTGTGGTGATCACGT
ACGCCACGACACTTGAGGACGGACGTGTTGTCATTGCCACACGCTCTGTCAATGTGGCGGACATCGCCCCTCTTGAGGGTTACGTGCGTGCTAACAACTA
CATCTCGGGTTACATCATTGAGGAGTTTAAGGAGGGTGACAAGGTGTACTGTGTCGTGACGCTCCTCGCACACGCCGATTTGGCGGGCTACATCCCACCT
AGCATCATCAACATGCTGGGTACGTCTTCAACCGTTAAGGTCCTGGAGAACTTAGAGGCAATTGTGACGGCCAAGTGAGTGACACGCAGTTAGACCACGT
CAGGCTCTTAGTCATCAACTTAGTGCTCGCGTAAACGACCTTTTACAAGAACATGTTTTGGGAATTCTTGTGATACATCTACATAACTACGAACTACGAA
TGTTCAGACTTTGGTCATCGTCTGAATGATGAAGGTGGCCTTGCAGCAATTGACAGGAGTGTGGCGAGCTTCGAGCGTGGATTGCACGCACTAACTAGAT
AAAGAAGGATAGCTTGGGGTTGGAGAAATCGACAGTGTCCATTCTATCAGCTGAGACGACGATCACAGCAGAATCTCCAGGGGTCTTGGATACGGAGCTG
TAGGTCACATCGTCATCACTTTCATCCCCGCCAATTTCCGTAGGTACAGGTGTTGGAGCTATAGTGAAAGCCGACTCGTCCGAATCCGAGTATTGGTAGC
TTGAGTTGAAATTATTCCCCGCATCGCTCTCACGTGACTGATCCGTTGACGAAGAAGTAGAGAGATTCTTCATATCTTGAACAACGGAGTGCAATTTTTG
TCGTTGAGGTTCTTCAATTCGTTCTTCAATTCTGCTTTTGTGGACTGGATCGCTACTTCTGCTTCGGGTATCCGAGTTACCACTCTCAGAGCTTTCGTGG
GTATCGCTGCCGCAGTAGCTTCCCTCCATCTTGAACCGCACTGAAAGCATTGTTGACTGGCGGTCGTTTCGTGGTAGGAGAGACCACAGAGAACTGAGTT
CGCGGGTACGTTTCCTATCATCCAGCTTCATCAAATCGCAATATTTGTCCCGCGAAATGTTAGCGACTTCGATCATAAATCCATCCTTGGCCTCGCGCTT
CTCTGGATCAAAATTGCTATCACCACGAGGCGCACAGAGCGAGACAACTACTTCCTGTGCACTTGTAGTTGATACCAGTCCTCGACTTGGTTTAACGACG
TAGCCCGACTGGTTTGACGTGCGCACCTTAAAGGTGAGGCAATCATTTTGACTTGAGTTCACGATAAACAATGAGGTGTTTCCCCAGAAGCGCGGCGCAG
GCTTTACGTTAAATGAAAGCATATCGCTGGGTTGAATGTGGTAGAGTAATGGCCCAACTCCGTGCGTTGATTCTCCGACTGTTGTGTCAGTAGAAATTGC
TGTCAGCATTGTGTCGCTGACAGAACTGTCACTCACACTAATACTGCTCAGCATTGTATCACGTTGTCTTGATGTTCTTGAACGTGTCGAAGTCGACATC
CTCGCCTCCGATCTTCTATCCATAATAGGAGGTTCTATCGTCGTATGGAAACTGGTGTCACTAGCAAACGATTGTTGTCGACTTCGTCGTTCCTCTTTGT
TCTCAGGTGGTGTAAACTGGTTGCTAAATGACCGGTTGAGTCTGCTACGATCGTTGTCACTGCGACTCAACCTGGTCTCCCTTGCACTCATACTTAAGCT
CCTGTTCTCACTGCGACTCGATCGATACCCCGAGCTCGAACTGGCACTACTCATGCTGCGCGACAGCTTATTCTGTGTCAACTCAAATGGAGGAATCCCC
GCTCCACCTGTAAAGCGACAGACCATCTTGTTCTCCGTAATACAATCTCTCGATACTTTCTTCCAGAATGTACGCAATGAAGAGCTCGAGTTCGAGTCCA
GTGGCTCCAGCGCTTGTACTCCTTCCTCACGCTCCACACTTTGCACAAGGAAGAGTTCCGACGACTGGCGGGTCATTAAATCCCTCGGGTCCATTGCTCC
CAGTCGATCACACGTCTTCATAGCAGCCGTTATGGCCACTTGAGTGCTGGCTCCGGACGCCAACATCCCGTGGGTTGGACGAACTGTGAATGCATCTGGA
TTGCGTGTCCGTACGCGAAAGACCACATCGTTCAATGGCGACAAATTCGTGAGTGTGAGGTGGCAACGCGGCCGCTCCGTCGTGTCACCC