Description :
From Genome Similarity Track
Location :
Scaffold_6:372815- 376814
Transcript NameFunction/comments
Physo_513129Eukaryotic/viral aspartic protease, active site
Physo_515387Eukaryotic/viral aspartic protease, active site

Sequence
3999 bases(100 bases per row)
CTTGGCCGGGTGCATCCTCGACTCTCAGCATCTACGGATCCCGCTATAGGAAGCGGCGAGTACGGCAAAGGAAGACCTGCGAAGGCAAAGGAAAGGAACA
ACAACAACCCGCAGGCAACCCCACGGCCGGATCCAGATCCAGGCCGCCCGATCCAAGTCGACTACCACTGGATTGGGAGTAACTACTGCGAACAGAGTGA
AGATTTCCGCGCTGCTCCACCCACATCCCCGCGTCTCGCCCAGACTGTTCTGTCTTCAAGGCTCGGACGCTTCAGCATACACCAGAGGAGCAGATCCAGC
CCTACCGACGGGTACACAAGGTGACCAGTTCAGCACACAGATCACGGATCATCGGGGGACCCCCTCCGTAAGTCGGTGTTCGGGCGCAGTTGGTAAGTTG
GATTGGCAATCTCGCAGATTTTGCTGATCCCGCTACGCCACAATGGTGCGCGTGCCCGAATCTTCTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAG
AAGTTTGAGTGAAGAAGGAACAAGGGGATCAAGCGTCATCGGAGTCGGGATCGACGACGACGCTGCTGAATGAACCAAGATCCACGGATCGGCAGAGTGC
AAGGAGGACCTCTGTCGGCGGAACCGAGGTGGATCCAGACATGGATCTAGAAGATAAACCTCAACCTCCTCCACAGGTCCCTTCGGGGACCCCGGTGGAT
CGCGACGCGAGTCAAGATCCACCAACAAAACAAACCAAGGCTGGCAAGGATCGGTATGCATTTGCTGATTCACCAGTTAAACCGGATGCCTACTTCTTGT
CTCCCGACAAGACCAAGTCGATGACACGAGCGAAGATGAAGGCCCCGGATCTGGATGACGATGATCCAAAAGCGTCATCCCACGAAGAATCCGAGGAGGC
AGGCTGGAGACGCTACCACGAGAAGCAGTTATGTGACTTCCTGGCTTGGGATCCCATGATGCGGCTTCTTGGCGTGAAGCCGATCGGAGACCTGCAGGGG
CCTGTGGCACTCCCAGCACCCGCCAAGCGCGAAGGGATCCTGGCCGAGATGGAGCGACTCATGCAGCTGCTGAAGGAGGCCGGCCTCGTAGCTGGCGCCT
TCGACGCGAGAGCGATCTACGACGTCGATCCAATCCAGATCCACGCGACGACGGACATGCTGTCCAACAGGCTGAAGGAGTTGGTAGGTGAGATCCAGCT
GAAGACGGATCCAGAAGTCCCGGATCCAAGTTCACCTCAAGCTGGATCCACAGGATGCCGAACGTCGTCACCATACGTGTCCACCGCGGAGCTTGGGTCG
GATACATCTTCGGAGCCGCGGCGTATGTCGCTTGGACCCTCGGGAGCCTCGATGCTACGCACCCGAGCCCAGATCCAACGTGAAGCAAGGACTCAGTCCC
GATCCCAGCCCCGATCCAAGAAGCCATCAACTGCTTCGGTGGATCCAACAGCTACGGCATCAGGATCGAACATATCGACCGGCAGACTTGTGTCATACTT
TCAGGCAGCCATGGGCAGGTTCTTGAAGGAGCAAGGCGGGTTGACCCCGACACAGGCGCCGGAGGCGACGCAGAACCCCGGATCCCAGGACGTGGAAATG
GAGTCCACTGGTTCGTCCGATCCAGATCAACACTGGGAGTACGATCCAGATGACATCGACTTCCCGGTCCCAGATACAGTGGCCACCACCGCGACCGGAT
CCACAGGTTCAGCCCTGATCCAACGAGTCCGGATCTCAGCGCTCTCGGATCTGAAGGAGTTCTCAGGGAAGGACCAGGATGAGGATCGGGCGAGAGCATG
GATCAGTAAGGTGAAGTCTGCGTTCCTCCGGGACCAAGCTCCTGACGAGGAGAAGTGCTTGACCTTCGCGGACCTTCTATCCGGATCCGCGAGAAACTGG
TATCGCCAACTACCGCGATCCACACGCAACAAGTGGTCGGATCTGCTCCGCAGTTTCCAAACCCAGTACTGTGGATTGGGGATCTCCGTTGCTCGCCAGT
ATTACCACGCGCGCAAGCGATCCGATGAGTCCCCACTGGATTATCTCTACCGACTTAATGTCGCTGGACTCCGCGCCCGACTCAAGATCAAGGATGGTGG
ATCCAAGGAGAAGCGCGAGTACGTGGATCACTTCATCGAAACTCTGGGTGATCCGGATCTAGCGGATCGGCTGACATTGCTCCGACGGCCGGATGCTGAC
GAGCTGGAAGAGGTCCTCCGCGCACTGGATCGGGCGAAGAATCGACAGAAGAAGCCTGCGTATGGATCCAGCAAGTACCGGCAGAAGGCCCCCGCGACGC
CCACACCGGCCACTCCGGCCAAACATGTGCGTGCGATCCAGGTCCAACCTGACTCGGGATCCGAGTCTGGATCCAGCGATGGATCTGACTCCGAGTGCGA
CGGTTACCGCAGGATCTATCTGGCAGCATCCCAAGACCACGCGGAGCATGCAGAGGAAGAGCAGAAGACTCTGGATCGGAACCCTCCAGACCGTCCACAG
CAGGATCCACCGTCTCGCGACTCCCGATCCAGGACGCATGCGGATGGACCCGAACGTAGTCGCTGCACGCACTGTGGATCCAAGCGGCACTCGCATCTTG
GCTGCTGGAAACGCTTGACCTGTGAGAAGTGCGGCAAGAAGGGTCATCCAGGTGACCACTGCCTTTTCCTGTGCCGTGGATGTGGTGAACTTCATGACGT
GGGCCGATGCCCGATGGAAGAGTTCTACAACCAGATCCGCCAGTGGTTCAATCCAGCCAAGCATGCGGGGATGCTGCCAGAGATGGCGGAGAAGATGTTA
AACTAGGACGCTCGCCGGGTTGGAATCCGGTACGAGCCGAGCGTTCTAGATATTGCATCTATGCATTTGTGAACAAGACATCGACAGATCCAGTTTGCAA
ACGACAGGATCTACGCGGTATTACATGTGATCTTCATGGGAAACGTACTGCTGTGGTCTCAAGTCTCCGACAAGCTGATGACTACTCCAGATCCGACACG
ACAGTGGAAATGGATTTGGATCCGGAGGCACGTCAGGGATACTGGAAGCAGCAGGATCCAGACCAGTGGTTTAAGCCTGCTGAAGGTGAAGACACGGCTG
GATCCAGATCCAGGCGTGTTGCTGCGAACCGGCGGACCACGGATTCACAGTCTTCGTATCTCCTACCCGGAGAATCCCGAGGATACTGGAAACAACATTC
GCCAGGGAAATGGTTCCGTCAAGCCAAGATCCACGGCAAGATCAACAATGAGAAAGCGATCTTACTCCTAGATACAGGTGCCGAGGTGTCAATCGTGGAT
ACCGCCTTTGCTCGTAAGGTTGGGTGCTACATCGACAGGAGCCAGAGCCAAGAGTGTGTTGGGATCGGAGACAACGTGTATACAACGGAAGGAAGAACAC
GGATCAAGATTACCTTGGGCGGATACCTGGTGTATTTCTTCGACATTTGGGTGGGTGACCTATCTGGACAAGAGGCCATCCTCGGTATGGATTACATGGT
TCCGGCCGGGATCCGGCTGGATCTGGCCGACGGGACTCTCTGCCTGCCCGATGAAGTCCGGATCCAGCTCAGCGGACGCCGTCCACTCTACAGTGACAAG
GCGCAGTCCGTGAAGCTGGATCGATACTTGCAACTTGGGATCGGAGAGTCCGCGGAGCTGCCCATGCGTCTGCGAGGGTCGGAACACGACAAGCTGTGGG
TTACGCGAGGGGATCGATGGGTGCCAACGGTGATCAAGGGCCCAGGCAAGGTACGGTACCTGCAGATCACGAACATCGGAGAGAAGGAGCTGGTGTTGCG
CCAGAGCCTCCAAGTCGGGATGTGGCTGGCCGGAGATCGAGTCCCGCGGATCCAAGGTTACGTGTCCATCGGATCCCGCCGCTACATAGAGTGGCAGAAC
CTCGCGCTGCAGGCCACGACGGATGCTGGATCCGCGGAGGCGGAACCCCCGGAGGCCCCACCAGGGCCTATGGTGGAGCGCCCCGAGTACCCGACGCCG