Description :
From Genome Similarity Track
Location :
Scaffold_1233:3726- 6541
Transcript NameFunction/comments
Phypl_g12835hypothetical protein

Sequence
2815 bases(100 bases per row)
AGCTTCCCGAGCTTCGCGGAAACCAGATGAAAACATCCCTCGGAATCGAGCGCTAAGTGCGGACAGAATCAACTTGTGCGCATACACCACGCGTCCTTCG
ACAAGCTGACGAAGCAAgcaaacaacaacaactaAGTCACCCCTTCTCAAATAAAAGAACACCCACACACAAGCGGAAGAAACAAACAGGAGAAGACAAC
TTACGAAGGAAATATCGGCGAACTCCTCGCAGTCAACATATTGAGCGAGCGCATGACGCAGCAttcttgctggcgatggcagcaACACTGAGGCGCGTGG
AGGGGGGTCTGTGTCTAACGTGAAGCAGTCATTTAGGTAGTCAGCGCCGCAAGAGCCGCCAAAAACCACGAGCATGCGGTCCACCACTGTGCACGtgtgt
ccagctcgtcgcccaGGGCCCCTCCCTACCACTAACAGCGGTTCTTCTCGCTTCCGTGTCTCCACGTCCGAGAACTCGCACATCTCGTTCGGGTTCGCCG
AGTCGCAGAGCCCTTGCGCCACCATCATGGCCTCTCCGTCGCTGTGCGCGTCTTCGAACTCCTCGTCACTGTCTAGCTCTTCGTCGAACTCTTCCGCCGC
ATTTCCGGACCAGCTCCCGTCCTgttggtcgtcgtcttcgtagATATCCCACCGGGGCTGGGAGCGTGTGCGACTGCGACTGGATCGGGAACTCTGTCTC
CACTTTTGCCTCTGCTCGTCCGGGTTCTTGGCCGTGACTACGGCCACCGTCTCCACCCACTGATGCCTGCTCGGGTCGTACACGTGGAGGTCGTCGTAGC
ACTTGGCCGACGGGCCGGAGCCTCCGAAGACGAAGAGTCGGTCTCGATGGCGGGCCATGGTCATGCCTGCTCGAGGCAGCGGCGGGGCCACGTACTGCCT
CGTGTCGACTCGGAACTCGTCGGCCACGCCCGACCACGTCATGCTCTGcgtgtccagcacgtggatgTCGTTGAGTCTCTGCCGGCCGTCCCAGCCCCCG
AAGACCAGCAGGTCGTCTCCgaccagcgccgagctgtGGTTGGcccgcggcgccggcgcgcggCCGCGCGTGCGCACGGTGGCCCACGTCATGGCGtcga
tctgcagcgcgtgcaggtcGTTGAGGTACTcgcggccgtcgccgccgcggaAGACCAGGATGCTGCGCAGACGGGCCACGTAGTCGGCCGTGTGCATGTT
GCACGGGCCgagcgcggccgccagcgcgggCTGCTCCCACGTGAGCGTAtccaggtgcagcacgtgcaggtCGGCGGACGCCAGCGGGCCGCTGCCCAGC
CAGCCGCCTAGGATGAAGAGCTtgcgctcggccagcgtggcCGTGTGGCCGTTGCGGCCCGCCGGCGCCCGGCCGCGAGTCTCGTGGGACAGCTCGCGCC
ACGTGCGGCGGCTCACGTCcaggaggtgcagcgcgttgtGGTTGCGGCGCCCGTCGTAGCCGccgaagaacagcagctcgtgcgtgGACACGGCCGTCGC
CGTGTGGTTCTTGACGGCCGGGGCGCCCGCGTGGCCCGAAGGCCGCAGCGACTCCCAGCGGAGCACCATTCTCGCCGGGGAAGGAGCGAAACAGCGCAAA
GGCGCGTATGAAAGCGTAGAAGGCAAGTCGGCACAGGTATAATATACACATTCTCAGGTACATTTACCCTTTTCTGGACCTTCAACTTGCCCAgaataaa
aaaaaaagctcTGAAAAGGCAAGACAAGACTTTCGTGCCGACACCTTGCTCTTCTAAAGCGCAACCAGGCATCACTCGAATCCAAGCTACCAAGAACCAT
TGGCTTGTGGTCTGCCAGCCCACTGCAATCTCTCTAAGAGTATCGATCAAGTGGATAAATATATTTCTGGGTTTCTATTTTAGTAGAAACCCAGAATATT
AAAATATTTGATACAGTGTGGTTACCTTAAAAAAATGATATGCACCACACACAACATTTATTTCCTACACAGACAGTTACTGTAGTGGAGCAGGGTTTGA
TAGTAGTGGGGCTGGCGCCTTGTTAGTACTAAGACTAAATATACGTACGTTGTTTTCAATATTGTAGTTTATAGTTCTAGTAATCGCGGTGAGCGGACTT
AGTACTAACGTTATTACTAAATATCGTACTATTATGGTACTAAACCGATTTGTCGCTGCCTCACCACATACCTCTTTTGCTTGCCTCCATCAGCTCAATT
TCGACATGGTTGTGGCACAAAACAAGTTGGcggtgcgcgcgctcgtTATCCGTACGCGTTCTCTGAGGGCTCATGACAAAAGACCCAGCTGAAAACACTC
GTTCCTGGAATGCAGTAGAAGAGCTACGTCCCAGCCAAGCTCTTGCGAGATTCGCAACCGACGGGTACATTTTCTCTCCAGAGTCAGCAAACCACTTGTA
AACGTCGATGTGCTAACAAAGCTGCTCCACATTCCAAAGGTTTCTACCGTCTCAGCAGCGCATAGTTAGTTTCACCAGGGCTTCTTTGTGCTCGATTTCG
TTGGTGATCCGGTGCTTCGCTATTTCACCCCACTCAATTAGGTGATTCAGCCACTTCTTCACGACCGCGGCTGCTTCATTGTTCAGTTCTTCGCTGAGCG
GGTTTTCTCCGGCTTGTTGTGAAACTACGTTGCCAGAGTGTAGGTCAAAATCAGCATCGTAGCGGGCCGAGGACTCAATAGAGGATGAGGAATGAGCCGA
CACACCAGAACCATTGCCCTGGGTATCGTATCTCCGCGGCACCTTGTAGAACACACGGTGCTTTGAGCAGTAGCTCTTTAGTATCGTCGAGAATTGCATT
AGTCACAGCTTCCGC