Description :
From Genome Similarity Track
Location :
Scaffold_36:372573- 379396
Transcript NameFunction/comments
Phyin_T30-4PITG_14607Putative uncharacterized protein
Phyin_T30-4PITG_1460839S ribosomal protein L24%2C mitochondrial%2C putative
Phyin_T30-4PITG_14609Eukaryotic translation initiation factor 2 subunit beta
Phyin_T30-4PITG_14610Putative uncharacterized protein
Phyin_T30-4PITG_14611Putative uncharacterized protein
Phyin_T30-4PITG_14612NADH dehydrogenase iron-sulfur protein 8%2C mitochondrial

Sequence
6823 bases(100 bases per row)
GCTCTACCAACTGTGGGGTGGTGCTGCTCGCCGGACGCTGGGGGGACATCCAAACAAGAAGCTAAAAGCGCCTTCGTTTGCAGCTTTGCGTCACCTCACT
TCGCCTTAGTTGCTGAAGTCATCTCGCAGCGGTGGATTGGTGAGGGATTGTGAACCGCAGCAGGACGAGAATGATAGCCCGTCTCACGCCGGCACTTCAG
TATGCTCGCTCCTTTATCAGTGCCAATACTAAGTAGTCTCAAAGTGCTCAAAACTTCGTCGACACGAACAGAAAATTATGCTGACGAGCAGGTTTTTTCG
ATAGGCATTGGTAATCACTGCACCTTGAATAGCTTCTACTGTAGACCATAATTTGAATGGATAAATGGTAATTATGCTTAAAAGTCTGTCCGTTCGCAAT
GACCACACTACTAATTTCCTGCGCACACCTCCAGCCCAGCTGCAGCTTCAGTACCGGTGGGAGCCGCTTTCTCCTTCTCAGTTGTCACTGTAGCCACTAC
AGGAGCGGGCAAAGGAGTATCGGGCTCGGATGCCGTGAACGAATTGTTCATGATTCGCCCTGGGTGTGATCCGCCCATGTAAGACGGAAGTGACGAAAGT
GGGATGCCGTGGTTCTGTGCCACCTCCAAGAATGCCTTCATGTCTTTCTGCGTAGTCACCAATCAAAAGGTACTCAGTACAAATGCACCAGTAGCTCTGT
TTCTCAAGACAAGTTACGTACAAACACTTGGATCTTTTCACGCGTTTCAGGCTGGATGACAGCCGAGATGACCTTCCAGGCGCTGTAGAAAATGAACGGC
GCATTCACGACGTACAGACAGTGCAGCGTCTCCGGGTAGTAGAGTTGACCCACGTCGAAGATAGGCTACACGAAAGAACACTTGTTGGCTTGGAACAGAT
ACGACATCATGCAATGTAGGTAGATAAATACCTTGAGGTGGCTCAGCACTGACGGCGATAGAAGCTTCATTCTGAGACCCTTCAGATCCACGATACACAC
GTGCTTGTAGACTCGACGACCGAGTCGCTTCGAGATGGCGACTTTCTCCCATTGGATGCGCTCCATGTACTGCCATCGGTGGGGGATGATATCTTCGGTG
TTGGCGAAGGTCTTGAACAACCCGTCCGGGTTGATATCGCTGAGGCGGTCCACCGTAACGAGGTGTCCCTCTTTATCTTCACCGTAGATATACGTGGGCC
AGTACTCGTTGTACATTTTGGACATGGGCAAGTCGCGTTGAAGGACGGTGTCGGCATTGTAGGCAGCACGAGCGTCGAGGATCTTCTTGGTCTCTGCGAT
CGTAAACTGCTGCCGGTTCTTTTTGACTCCGCGATAAGCGCGAGCCACGCGGATCGCGAGGTCGTCCGTGCACTTGTCACCAAATTCCGCCTTCACGGCA
TCGAAAAAGGGCTGATCCTCGGCCGAAAGGGGAAGAGCCTCTTCGTTTTCATGGAGAGACATGATTCACGCTGGCAGGAGACCGCTCTAGCGTCAGAGCT
CCAACAAACGAATGCAGGAAGCTCCGACAAGTAGAAAAAACTGCTCGTGTGGTTGTGCCGCAAAGCCTCGATGAAGCCTCAGCGTTCTGAGCTGACCTGA
AGACGCAGATAAAGAGTCAGAAGGCGGTTGCGTGGATGCGTTTAGGAGAACGAAACTGAAATTAGGCGACAACGGTCATGAAGACCGTCATCGTGCTCCT
GTTCCTTCTTGTCTATCATTATCTCGAGAATCGCGCACGAATCCTTCGGTCTCCTACAACTGCGCGGATTACTTTCCTCCTCGCAACGACTTGAAACTGC
GTGACGCTTACAAACGAGTGACCTCCCAGTCCTTGACCGTGCGCTCCAAGACGTCTTCGGGTGCCGTGTCGAAGGGGCCCGTTTCTGGAAGAAATTAACA
ATAACCACGACGATAACAGAAGTGTCAGCTACGAATAACAACAATCACGACAGCTACGAAGCCAGCTAAATGACAGCAACGCACCTGTTCGTCGCGGGTT
GTGACGCTCCTTGAGAATGGCTGGCTTGGGAATAATAGTGCCCGTCTTCTTGGACACACGCACCTTCTCTCCCTCTTCCGTAAAGCGAATGGCGACCCGC
GTGGGCTTGCCGATGGACGGATCCACGAGGTTCACGTTGCTGTAGTGGATGGGAGACGGCGACAGGTACGAGCGGCCGGAAGCGGCAGGCGTCGCCTTCA
CGTAGCGGTGCGACTGCATAAGTTCATCGCAAACAGGTCAGATTTTTTAAAGCTACGAGCAGTCTATAGAGCCTCGTTACGACGCACCATGTTGACATTC
TCCACGATGACCTTGTTTAGGTCGCGTACAACGCTCACGACCTCACCTTGCGTGCCCTTGTGAGGTCCAGCGATGATTTCAACCTGCAGTAAAGCGATGC
CACAGGTTAGAAGAGGTTAGAGAACAATATCTTCGCTAACACGGCGAGTTTGGAAGCGAAAAAAATCGCACCTTGTCACCGCGGAAAATGTGCCAGGTAT
TGATCAGGTCGATCGCTTTCTTCTTGGTGCGCGGGCCGCGACGGAAGGCAATCGGGATGCGTGTCGCCATCTTCAGCTACAGGGGCGTTTGCTGTCCACA
AAGTACACTGCCATTGTAAGCCGAGCAGCTTCACTTGACCATTGGATGAAATCACAGATAATGAAGTCAACCACTGGCTAAAATGAACATTGTTAGATTG
GATGAAAGTGCTGATTAAAAGCTAAAACCCTGGCTTATCATTCGCTGAATTAAAGAAGCCACTAGAAAAGTCGAGGGAAGCGGGCAGGAAAAAACAAGCG
AGCCACCCGCACCAGCCAAGCTAGAAGGGAGCACCAAGAAGATTTACCATGGCTGACGTCGCTGAGAAGCAGGAACTGCCGCCCGTGGGCGAAGCCGGCG
TGGCCCCGCCCGCCGTGCCTGAGGATGTGGCCGCCATGTTCGATCTGAAGAAAAAGAAGAAAAAATCAAAGAAGGTCAAGAAGGAGGTGCGTCGAAAAAT
CCCATCGTTTTTTAACACGAATATGTTAAAGTGCTGTATTTACTAAATTTAAATGATAAATTATTTCTTGTTTGATGTCGATAGAAGAAGGAAAAGACTG
AAGACGCCGATGCCGCCGCAGATGCCACACCCGACGCCAGCTCGGTGTTGGTTCAGGACCCCGCGACGTACTCGTACAAGGACGAGCTTTTGGCGCGTAT
CATGGCCAAACTGCACGAGAACAACCCGGAACTGACGGACCGCAAGCGACACACGATGAAGCCGCCGCAGCTCATGCGTGTGGGTACCAAGAAGACACTG
TGGGTGAACTTCCAGGAGATCTGCCAGATGATGCACCGTTCGCCCGAGCACGTGCTGCAGTTCACTTTGGCTGAGTTGGGTACGGAGGGATCTATCGACG
GCAACCAGCGTCTCGTCATTCGCGGTCGCTACGTGCCCAAGTACATCGAATCGCTGCTGCGTAAGTACATTACGGAGTACGTCTCGTGCCAGATGTGCCG
CTCGCCCAACACGACGCTCACGCGCGACTCGGTCAGTCGTTTGTACTTTGTGCACTGCCAAGACTGCGGCTCGTCTCGATCTGTGGCTGCCATTCGCTCG
GGTTTCCACGCCGCTACTCGTGCCGACAGAAGGGCTGCCCGCAAGTAAAGACTGCTGTCTGTAAGCGCAGTCGCGTAGGACGCTCAGTGTGGACAAGGGT
AGAGCAAGAAACTGGACACTCCGACGCTATGACGTTTTAGAATTTCTCTGTTCGTCACGGCTAGAGCTGCTCTCGTGGGCTTAGAACTGTGAGATACCGA
CGAACAACGAAGCGAGAGATGAACACGGAGAAAAGAAATCTATTATAGCTGTTCGGTGTCACTACTGTAGACTAGCTGGCAGTCTTTTATCTCCTGACTT
AGTGACGATGCTTACTCTTCTTGGTCTTGTGAGATTGGCCAGAACTCGCTGCAGGACGCTTCGCTCCATGACGGGAGATAATGATATGACGCTCCAGACC
AGAGCCGATGCTCTCGTGTGCGAGGCCAAGGCGCTCGGCACAATCGTGTGCTAGTAGACGCTCGAAGCCATTCAGGTTGGCGTCCAGGTGCAGCTCGTTG
CCTTCACCTGAGTTACCGAAACCCTCAATCTTCTTGACCAAAGTATGCGAACTGCCTTCTGAGATGCCTCCTGCCTTGTGGTTGCGTGCACGAGGTGCTG
GTGTAGGCTTGGCAGGTTTAGCAGGAGCTTCATCTTCAGAGTCTGAGGAGTCTGAGCTCGAGGAAGACGAGGAAGATGATGAAGCGGCCGGCTTAGTCTT
GGCCACGGGTGATTTTGTAGGAGTCTTGGGTTCTGGTTTCTTCGCCTGCTTCACAGTAAGTTTCTTGGCTAGAGCTTCATCGTCCGAGTCGCTGTCGGAT
TCGGAAGATAATTCAGCTAACGTTGGCGTACGAGTTGGTGCTGGCGTGGACTGTACAGCAGGTTTCGAAAGAGCTTCATCCTCCGATTCATCTCCAGACT
CGGACGATACGTCTGCCTTGGCGGTAGGCGTTGGTGCTGGGGTCGGTTCTGAAGCCTCATCGTCGGAGCTGTCGGAATCGGACGACAACTCCATCTTCGG
AACTGAAGCAGGTGACGGCGTTGGTTTATCGGCAGGTTTGTCGTCGAAATTCTCTTCAGCCTCCGAGTCGGAAGAATTGGAGGCTTGTTCTTTGACAGCA
GGAGTAGGGGCCACAGGGGCTGAAGCCTGCGGTTTGACATCGTCAAAATCCTCCTCGGACTCCGTTTCAGACGCGTCGGCCATGGGTTCATCGTTATCTG
TACTCTGTGTAGTAGGCGGCTGCATCTCCTCGTCCTCAGACTCGGACGACTCCGAAGAAAACTCGAGTTGCGGGACGCTCTCGACGTACGGTACGGGGTC
GACGACCTTGGGTCGTGACGCCGACTCCACCGCTTTCTCTTTTTTCTTCGTCTCTTTGGCTTTCGTAGCCTTTGGCTCTTCCTTGGCCTTTTTAGTGGCC
TTTGCCTTCTCAACTTTGCCTGCCAGTTTGACGCGAGTGTGTTTCCGCAAGCTTTTAAACTTGTGCACACTGGCGTCGCATGAGACGCAGAACGGTACCT
CACACTGCTCACATCGCACACTGGCAGTAGAGGCCTCGCACTCGCCACAACGAGGCAGCGTGGGGATGGGAGGCAGTTTTGTGCGCTTGTGCTTAGCCAT
CACACGAGCGCGATGCACAGCCGAGTTGCAGTCGTCGCAGTAAAGCGAGTTATCACACTTTGAACACTTCCACACAGCAACATCAGGCTTCTCGCACTCG
ACACAGATGCGCGTATCTTCGCTTTGTTCACTTTCTGCTTCTGCCTCTGCTTCAACCTCGCTCTCACTCTCCTGTTCGCTTTGGACAGACGTCTGGGTTG
TAGACGTCTTCTCTGGCCTAGAAACTGTCTTGGCCTGGTGAATAAATCTGCAAGCGTCACCACGAGTGCACACTCCATTGAGGAAGAACTGACACAGCTG
GGCAACTTTGCCAGTAGAAGCAGGTACAGCGTCCTTGGCCACGCCTAGCACGTGTGCAAACGTGCATGCCGAGCCTTGCGCACAAAATCCACGCGTAAAG
TGACGACAAAGCTGCGTGGATGGGACCCCTTGAACGTCCGAAGGTACAGCGGCCGGCTCTGTCGATACTGGCTTCGGCGTTTTCGGCTTTGGTGTCTTCT
TCTTAGCTTCGCGTGAAGCTTTTGCAACGACAGGAACGGGTGATGCAAATGCAGCATTATCGGTCACGTGGTAATACTTGCACATGTCGCCCTTGCGGCA
GATCCCAGCAGCGAAGCCGCGACATGGCTCCGTCGTTTTCTTAAATTTGCGCTGTAGCGACACTTTGAGCGTTTTACCGTACACTACAGCGTCATTCGTT
GCCTCTACTGCTCTCTCTGCGTGCTGCTTCTGCGCAAAAACCACTTGACTGCATGAAATGCGATGAATTAGAGCAATGCATTGGACGATTGGAAAAGTGC
TTCGACGTACGCAGAGTTGGTTCCGTTGTGTCGGACGCGCACGATGGGGCCGTAAGTGCGGTACATGTTCATGAGCATCCCATCGGACAGCTCGGTGCCG
ATACCCGACAGCACGATGGTCGCTTCCTCACCGACGTACGCCATGGTGAAGGTGATCAACTAACTGCCAATCGAGACTTTGGCTGGTCAGCGTCAATACG
TCACTAAAATGAGGTGAAACACTGTCAGTGTCATTTAAAAGCGAGGACATTACCGGTATTGTGGCACAACCATGAAGGACGATGGTCGAGCTGATGCTGC
AACAGGAAAGCGACGAAGAGCGGAGAGTGAAGGAATGGAAGGAAGGAATGAGGAGAATGACGTGCACGTTACAGAGCAGACAAATGAGCAGGTGAACGCT
AAGCGAGACGCAAACGAATTGGAAGATAAAGCTCCGGCTCCAAACTCGGAAACTGGCGATGCCGACGAAAGTGAAGACGAGGAGGAGATGCTGGTGGTGC
TGGAGCTATGCGACTTTAAGAACCACCCATTGTTCGATGACTACAGCTCTGCGACGCTTGAGGTGCGAGAACTGTTCAATGGTAGAGTAGAAGGACTCGG
ATGTTGACGTTGTGCTGCTTGGTTCGAATGACTAGGGCATCGACACGGCAAGGCCGATGCTAAAAATCGGAGAGTACGAACTGCATGGGCAGCTCGAGGA
GACGGTGGGGACGAGCTATTTCTACGACACGGACACATCCAGAGTACCAGACAAAACGTACCAGTTCGCTGGGCAGACCATCAAGAAGATCAAGTTCACA
ATTGCACCGCCGGAAGACGCGTA