Description :
From Genome Similarity Track
Location :
Scaffold_191:37251- 39650
Sequence
2399 bases(100 bases per row)
TACGTCAAGGCGAGCAACATTGCGTTCGGACTGATGTTGCTCCACATGAACGCGGACTACCATCACGTGGTTGATGACTGCGAGGAAGCGTGGGGCGCGT
GGACGCGCTTGAAGACGCTGTATGGTGGGTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGCAATGT
CTTGCATCATTGCAACGAGGTCCTCAACATCAGTGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGGACGAGGACGTGGCGATCTGCTTACTGCGAAGT
CTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATAAGCAATGCAGAGCTGCGGTCGCAAGACGTTGTGAAAGTGCTCACAAACGAGCACATCA
AGCGACAAGGTGAGAAGACGGCGACGGTGAAGACTGAAAACGCGGCCAAGGCGTTCAACACCGACCGAGAGTCTCGCCAATGCACGTACTGCGGGAAATT
GGGGCACATGATTGACAAGTGCTGGACCAAGCAGAAGGATGAGGGTCGAGGTGCTCGACGCGGCGGCAACGGCCGTGGACGCGGAGCTAACAACATCCAG
TGGCGAAATGACGGCGACGACGACTACGACTACGATCGAGTAGCGTTCGCGGTTTCCCTGGAATGTGAAGTATCGACGAACAAGAATGTGTCTGGAATGT
GGGCGGTCGACAGTGGTGCCACACACATCTGTAACGACAAGTCCAAGTTCGCCAATCTCATCGAGCGCAATGAAGGCGAACTTTCGGTGGCCGACGGGAA
CAAGGCGGCTATCAAGGGTGTGGGGACCATCGTGGAAAGAGTGGTCCTGCCCAACGGCACCGAGCGCGAGATCGAGATCAAGAATGCGCTCTATGTGCCT
AACATGAGCAAGAATCTGCTTTCAGTACCGCAGATCAACAAGAACGGAAAGTTCCAGGTGGTGTTCGATGGCACTGAGATGCACATCTCACGCAAGGACT
CGAATCAAGTGGTGGCATCGGCGGATCTCGTAGATGGACTCTACTGGCTTCGCACGCCTCTTCGATCAGCAAATGCGGCGACAAATGGAAGGACGGTCGA
CCTGCATGCGCGTATGGGTCACGCTCCAGTCGAGGTGCTTCGCAAGATGGTCGACAACAAGATGATCAAGGACGCGAAAGCACCTTCCAAGCCTAGCGGA
CCAAGTCTGTGTCGCGGCTGCCAGCAAGGCAAGATGGTCCAAAAACCATTCCCTACCAACCGTGACAAGCGTCGCTACGACACTTTCGAGTTGCTTCACT
TCGACATTTGCGGACCCATGGAGAAGTCCTCGCTTGGTGGCAGCAAATATTTGCTACTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGCTTCTGTCT
GCGTGCCAAATCAGAAAGCGAAGACTGCATCAAGACGTACATCACGAAGGTGCAGAAGCAGTTTGGCAAGAAGGTCAAGTTCGTGCGACACGACGGAGCT
CGTGAGTTTGCGACTAACTCGCTTAAAGATTTCTACGAAGACGAGGGCATCGAGCAACAAACCACGGTTCCGTACGCGCACCAGACTAACGGCACGGCAG
AGCGGGCCATCCGCACCATCGTCACGATCGGCCGCAGCATGCTGCATCATGCCAAGCTAGACAAGTGTTTCTGGGGTGAAGCGGCGATGACGGCCATCTA
CGTGAAGAACCGCCTGCCGTCACCAAAGATCGAGTGCAAGACTCCGTTCGAAATTGTGTACAAGTCCGCGCCGAGTGTGAAACACATGCGCGTATTCGGC
TGTCGAGCTTTCATCTTAACTCCAAAGGAGAAACGGCTCAAGTGGGATCCAAAGGCTCGCGCCGGATTGTTCCTGGGCTACGAAGAAGTATCCAAGGCGT
ATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTATCAGTCGCGATGTCAACTTCGATGAATCGACCTTTGGACTTTCAGAGCCAATTTCCGATGAAGA
CGTCGACGACCTGGACTTCGAATCTCTCGACATCGACAATGACGGTTCGCGTCAGACGGAGCACAGGCAGGCGGGAAAGCGCAAGAGCCGCCCGAGTGAA
GATGAATCTGCCACAAGACCGCGAGCTACGCGTCATCGACCCGGACTGGAAGAAGCAAGTGCGCCGACCAATTCGTCTTCACGTCGAGCAGACGTAAACG
AAGAAGAAAAAGCTGGAGATCAAGATGAAGAATCGACTCCCCCCGTGTTTTGGCGTGCAAGTGCCAACGCAGTCGAAGCTGCGGTGGACTTATCGGAGCC
AGCGACTTTCCAAGAGGCGGTGAACGGCCCCGACCAAGTGCACTGGCCGCAAAGCAATTCGTGCTGAGCTCAAGTCGATGCNNNNNNNNNNNNNNNNNN