Description :
From Genome Similarity Track
Location :
Scaffold_883:3725- 12708
Transcript NameFunction/comments
Phyta_totarag11178cyclic AMP-dependent protein kinase-like protein regulatory subunit
Phyta_totarag11179ATP-dependent protease hslV
Phyta_totarag11180hypothetical protein PHYSODRAFT_323413
Phyta_totarag11181hypothetical protein PHYSODRAFT_553034

Sequence
8983 bases(100 bases per row)
GCAACAGTTAGAATGTCTTACAACCACCAAGAGCTAGGGTGTGTTCTGCAAATCTGCCATTTCAAAACGTCGGAATTGGATttccgcagcagcaataccA
TTCTGCGGATTGAGCAATCCGCCACTTAGAACGCAGAACACAATTATTAGGATCCGCTAAACTGCATCATCAAATGTAGTACAGACTACGATATAGTGTA
TTCATCTTAGAAACAAAGGTAAACGGAGAGCTAAAAAATAAATTCTACCTGAACCTTAAGTTGCACGTCTTGTCAGTAGCCAGTCGTTTTCGTGTCGTGT
GCCTTGAACTCAGGGTCGTCGTTTAGACTTTAACGCGCCTTGCTTTCAGCGTCATCCCTATGCTCAACTCCTGCTTTGTACTCGGCGACGCTTGAGCTAT
CGTCAGCAACTTTGCCCTGGGCACCGTCAACTTTATACGGATGCATCGCGACGAGTTCGCAGAAGTTGATTTGCCTGCAAACAACCACGTAAAGGAAAAT
GCTGGCGACGACACTCACGAAGGGGCCCCGATGACACCAcaatggagaagctgcgtgACAAGATTGCATCAGAGACACCTTGCACGAAGACATGGAACAG
TAATTGTGTAGCACATACAACCACGTCATATCTACTTGAATAAAATATACTTTTACAGGCACCCATCGCCAATCCGCCAGATGCATCCGCTACACGCCCG
AATTCGTACGTGTTAGATCCGCCGAAACGAGACCCAAAATCCTCAGATTTGTGCGTGCAGAACATGATGGCGGATTGGTCAATCCGCCAAAAGGAGGCAA
ATTCGCTGAAATTCGTGTCTGCGGAACACACCCTAGTCATTTGGGACAAGGCAGAGAATACATACACAATCTAGAGGACGGATGTCGcgaaccgtcaaat
cacaaaatcggaggtgtcgacatgaatTCTGTTACCCGGCCTAACCCCAAAAACCATTATTggaagggcttaaccctataggatcgagtagaaggtgacc
atgattggtcctgggtttaagcccatatgctacgcacacggacaGGCATTGTTTTGGGATGCCGAGCGAGTGGGCTTTCACTTGGCATTttcgttttttt
taaaaggACCAAAATGGGCTGGTATTGTGAATCGTCACTCTCTTTTGGCTAAACTCTCACCATCCAGAGTGGTGGGCGGCCTTCGAACGATGCAGAGTGC
TTTCGGGTGAGTTGGGCCGGAAGCGAGGCTAACTTCTTCGGATGTGATTCATCAAATGGTCCTCTATCATAGTTAACCACCGTTAGATAGAAATAATGTA
CCATTAAAATTTAATGGCAACAAATTTTGCATCACTAATTAGTAACTTGAGGACAGAGGTAGTTTTGACTAGAGGTTTGTAAAGCGTGGGTCAGGTCTCT
GTCAGCTTTAGTTAGAgctatttgggatatcacagcggagaggattgtctgtacataCCAGTAACTACACGACATACAAAAGCTGCCGCTGAGAGAAGCC
AGCATGCGTGCAAAGCACGCCTTAGGGTGTGTTTTTTTAAGTAGTTAAAAAAAATTATTGAGTCTAAGCTTAGAGGCATTTATTCCAGATGACCATTCAG
ATTTTTCATTGGCTGGGAAAATGTGTCTGAGACATCAATTTTTGTCATTTTGTGCGCCGCCCAAGCGTCGCGAGCAGAAAACGCAGAAGCGCGGTCGCTA
TATAAATATATCCGCGAGCGTCGCAACAGTCTATCGACAGGCCGCAGTCCACAGGAAAGGAGTAACGAACGCAAGTTGAGCGACGCCTTGTTCTAATTCG
GGAGCCATCTGCAAAGTGTCTATCCGAAATAAGCGCGACTACAGAGCGATCTTTCAACCACGCTTGGGTTCAGCGTCTGTTGCAGGAGTTTCTTCCATTT
TGGAGCGAAGGCCGTGTGACGCCAGCCTCAGTTTAGTTCAGGgcgcagaagcagagcgGAGCGATCCTCTCACTACCAAGACAGACAAACAGACAGTCAG
GCACTcgcacagcacagcagtATGACGGACGCAGAGGGTgtgcagcaggagctccaGGATTACCTGCACAAGAAGGGTATCAACACGCTGTTCATCAACC
TGgtggagtcgctgctgctggccaagccCGAGAACCCCATCCTGCACATCATCCAGTACCTGCAGGCCAACTACCCGGAGGAGGCCACACCGCGCCACAA
GCCAGGGGCCAAGGAAGACAATCCGGCGGCCTCGCCCCATTTGCCATGTACGCGACGGTTAGATTTGATGCCAGTGGGAGAGGGAGGGAGGGAGTTGTAA
TGTGAAATGCTTGCtgtcttgctgcttgcagacCACTCGGACGAGAGTGAAAgtgaggacgaagacgagggcGGAGACGCCGTGGGCGAGATCGCGAGCG
CGCCGCCGCCCAAGATCATGGCCAAGGGACGGCGCACTTCGGTGTCCGCTGAAACCATTGACCCGCTGAGGTTCGTGATGGGAGTTGGCAGTGCTATCTA
TCTATATGTGGACCTCGTGGCTCTCCGTCCTGTCTGCTGTTTGGCTCATTTCAACCAGCTGACTGACTTGTTGTTCTGTATGTGACGTGGCAGTGCGCGG
CAGTTTGAACGCGTTGTGCATCCCAAGTCAGCAGAGGAGAGGGAGGGTATTAGCCGCATGGTGGTCGAGAACATCTTGTTCAAGTCTTTGGATGAAAAAC
AGCATGAGATCGTGCTCGACGCCATGTTCCCGAAGGAGTTTGAGCCTGGTgacatcatcatcaagcagggagacgatggagacaacTTTTACATCCTTGA
GAGCGGCGTCTGTGAGGTTTACAAGGACGGCGATCTCGTACAAACGGTACGTCGCACATGATTTGCCTTACAGCGGCATCTTTTTAATGTGGTGCCTACG
CTTCTTGCTTTCTTGTTGCTTTCCGTGATGCAGTGCACAGAGGCGATGTCGTTTGGCGAATTGGCACTCATGTACAACTCTCCGCGTGCTGCAACTGTGA
AGGCAGTGCAGCACTCGAAGGCGTGGGCATTGGATCGACAGACGTTCAAGTTCATCATCATGGAGACGACGTTAAAGAAGCGCGAGGCACACAAGGGCTT
CATTGAGCGTGTTCCGCTGCTCGAGTCACTGAGCGAGTACGAGCGCCTCACAGTGGCGGATGCACTCAAGACAGAGACGTTTAGTGACGGGGAAGTCATC
ATCAGTCAGGGTGACGACGGGAACCTGTTTTACATTATTGAGGAAGGAGCGGCAGTGTGTACGAAGCAGCTCTCACCCGCAGACCCGCCGGTGGAAATGG
GCCAGCTCACGTCAGGCGCGTACTTTGGTGAAATCGCACTGCTAACTACTAGACCTCGCCAGGCAACAGTAACCGCGCAGGGCAAGGTCAAGTGTCTTAC
ATTGGACCGTAAGACGTTCAAGCGGGTTATGGGCCCGCTAGAAGACATCTTGAAGCGCAACATCGACAAGTACAACTCGATCATCGCCAACAACATttaa
gcagcagcaggaaacaAGCAAGCGCTCACGCGCACAATACATTTATACACGCCTTCCAACCATTATCACGATTTTCGAGAAGCAAGGGTCGAAAGGGCCG
AAAGGATCAAGTAACAGCGGACAACAGCGGGCACCAATCTTTCCCTGCAatgaaggagctggcacAAGTAAGTCGAGGAGCCTGTGTCTCATTCATTTAT
CGGGTGGGTGGTGTTGATCCAGTTACCTCTACGACAACTGTTAGCGTTCTCCTATCTTCCTTTGCCCGACTATGATTATCATATTCATCTTTTCTTCTTT
CGTGCATCTTGATTGCCTTCTCTTTCTGATCGCGTTTACTCCTTGACTGTCCCAAATCAAACAGGAGCGACGGAGGGGATAAGTGAGCTTCTGCACATTT
ATTGATTCCAGCATTGCTGCAGAATTGCGCTATCGCTACAACGCTATGCAGAAATCTCGATGCAGCTTGTTCTACGTCGACTACGCCTTGTTTTCCTTCT
CAACGTCGTCCTTGccctcctccagcatctctACAACAACGTTCTCATTCGTGTAAACGCAGATGTCGGCAGCAATCTTCATGGACTTGCGAGCAATCGT
TTCAGCGTCCAGATCCTGGTCGATAAGGGCACGGGCAGCCGCTACAACATACAAATTGAGTCGGTCATTATCCTCGCTTCAACAATACCTCAGTAAAAAT
AAAGCTACACATACCGAGAGCGTAGGTGCCTCCCGAGCCAATGCCGATGATGCCGTCGTGGGGCTCCAGCACGTCTCCATTGCCCGTCAGCGTGTACGAC
TGCTTGACGTCCGAGACGATCAGAATGGCCTCCAGACGACGCAGGTACTTGTCCGTCCGCCAGgccttggccagctccacaCACGAGCGGGTAAGCTGAC
CCGGgtactcgtccagcttggcctccagACGCTCCATGAGCGTGAAGGCGTCGGCCGTGGAGCCGGCAAAGCCCGCCACGATGTGCTCACCAATGCGACg
caccttcttggcgttggGCTTGACCACAGTGCTGCCCAGTGACACCTGGCCGTCTCCGATCAGACACTGCTCCGAATAAAAAGAGAAAGCAGCACAAATT
AGCACTCCCGCTCCTTCAGTTTAGAAGCTATCGTTGCTCTTCAGAACGCACCACTTTGCCTCCTTTGCGGACGCACAGGATCGTCGTGCCGTGCATCTAA
CGCCAATCAACATCAAAACAACGTTTTAGACGCGAGATTTTGCGTGAATTTCAGCGGAACTCGACGCAGATTGTACCGTGGGGGCGTCGGAGAAGCGTGC
AACTTGCGTGGCGCCGATGTTGGCGGTGGCAGTCGCTAGCAACGGCGACTTGCGCGCGCTCGAGCAGGCACGGAACAGCGAGCGAGCCAGCATCTTCCTC
TAAATGAATGTGCGCTCAACGAGGGGCtatcaagcagcaacttACCAAATTCACGCAACGTTCGCGCGACATCATAACCGCGAGACATTTAGAGCAACAT
AAAGCAAGGCGAAAAAATATTGTGACGTTAGCGCAACTTCGGACCATCATTCATGAGTTCCTCGTACGCGACTAGCGGCCCGCCTTCTTCAGGCGGCGGG
GGCGCCCCGCCGGCGCCGTCTCCGCCTTCCCCATCCTTGCAGCCCACACTCAAAGGTACGCAGTCTCTTCCTCCGCCCTCTTTCATGTAAATTAACGTTT
GCTCTCGTATATTTCCTGATATCTATCTTCCTAGTGATGCGGCTATACAAGCCCAAGCTCTACGTCCAGGGCGCCAGCGGGGGCTCCATGCTGCCCACAT
CCATGGCCGAAGCCACCGCCATGCAGCACGAGTTCGCGCTGTCCAGTACGCTCATCCTGCCCGACAGCTTCGGGTACGTACGCACCTTGGGTTTTCCAGT
CGTGACATAATTTCTTAATTGTAATATCCGTTGATGTATTATTCCATTACAGAGAAATTTTCTTGGgcaacaccttcagcagctaCATCAGTGTCATCAA
CCCGTACTCGTGCGAGCTGCGAGATGTGGGACTGTCGGCCAATATTCAATGTGCCAATGACCGAGTGGAACTGCACGACAACCGTTACGCGAGAACGGGC
AAGCTGCCACCTCCTAATCCTGTTGCGGTGCTACCTGCTGGCTCTAGTCTGGATATGGTGGTGGATTATCCACTGAACCAAGTGGGGAACCACGTGCTAC
GTGTGGGTGTGGCCTACGTGGACCCTGTGACGGGCGAGAGCAAGTCTCTGCGCAAGTTCTACCGGTTTGGAGTGCAGAATCCTTTGATTATTACGTTCAA
GCAGAACTCGAAGCCGtcacaacagcaacaggGCGAGGCAATTGTGGAGGCGCAGATTCGCAATGTGTCCAAGCTCCCGCTTTTCGTGGACAGCATCAAG
TTCCTGCCATTGCCGCCGTTCACGTCGGAAGAGATGCAAGTGAATGCTGTGGGCAAGAAAGAAGGAGAGAAACCATCGATGCAAGACTTGTTGTCACTAA
ACAACGGACCACAGACACTTGTTTACCCACAGGAGGAACTTCAACGCGTGTTCCGTGTCTCGTACGACCCCGCATCGGACCCAACGTTGCTAACGACGCA
GGTACTGTGGAGTGGGGGGCTCGCCGATGTGATGAAATCTGCTGACTTGGGGTATTTCGTAGGGTTCGCAAAATCTCGGCCGACTTCATGTGGGGTGGAA
AACATCAATGGGGGAAGCAGGATCAGTGCAGAGCCAGCCCGTGATGCGGAAGGTTCCTGGCACTGTTGGCCACaccggagctggagctggacaacaCAGC
GAGgtagctgtagctgttgAGGAGCTTCCTAAGGAAGTGATTGTTGGGCAACCATTCTTGGTAGCTGTATCTGTGACTAACAAATCCACTCGAAGTCTAG
CACTTCAGCTGCAGTTCCGTAAGGAGCTTATGCATGGCATTGTCTGTTCGTCTGCATCTCACCAGGTATGTTCAAGTTGCGACTTTGTTTTGAACGGGTG
GTTTGTGGCTAATGCTTTGATTTTTAATTTCAACTTCGGTGTTTGTATGACATAGAATATCGGTTTGACGGAAGCGAAGACTGCAAAAACAGTTTGGATC
GAGTTTCTGCCTGTGGTCGGTGGGCTTCGGGCGCTGAATGGCCCAGTCTGTGTCGACATCCGATCAGGTCAGGAATTCGCTCAAACGGCCGTACTAGCTC
ATGTACTGGTtgcaccacctccgccgccttGTAAGACAATCGAATAAGGTGAAACGCGCCACTGATTGTCCAATGTGTTCTAACGTTATCCAAAGTTGTA
TTGCGGCTCACTCGTTCTCAAAATTTCCTTCTCACGGCTAACTTACATTATACAGCACATACTAGGCTTATTCCGCTCTGGATATGAAGCAAGACAAGTG
AATTCAACCTCGCCAGCCAAAAAGACAGCTCCTGGGTTGATTTCGACGGCGTTATCTTCTTCGAGGCGTACGAAGGTCCCCCACTTGCTGCCGTTATCGT
AAAGCCAGTACCTGCCGTCGTGGTACTCAATGATAGCATGAGTGCGCGATACATACCGGTCATTGAGTTCGATGTTCGCTCCGCTAAGAAGCCCACCTAT
GGATGCCACATTACGAACTACGTGAATATCACCACGCTGTGCCCCCGCTAGTACGTACAGAACCAATGCGTTTGGTATCTGCACGTCGTTCTGGGTTTCC
AGCACAGTTTGCTCCAACAGGTGTTTGTTGCGCTTTTTGCGCCTCCaccgacgtgctgctgtggtaTCACCCTCTCTATCAGACCCGTCCAAGGCGTTGt
gttcatcgtcatcaccgGTATTACTGTCGTCACTATGCAGTGCACTGGTCACTACCTGTGAATGCCTCCCTCCTACCTGCGAGTTACCTCGTTTTAGTGG
AGGTGGAATCTGAGCTATAGTAGGTGTTTCGAGACCAGAACTAGGACTGTGATGTTGCTTCGTTGTCATACCTACGTTGAAGTGTACAAGGTGAGCTGCA
GCTACGAAGTAGCACTCAACGGTGGAGTTTGCTTCGAGGCGGAACGATAAATCACAGAAGCTTAACACCGACGGGGACGAGCTTGAGCTCATTGCAACCA
CTGGCTCCATGGGACTCCACCATTCAACCGGTTCCTCCTCCGAATCACCATCGACATCGTGAATTCTATCCAAAGTTTGGTGCTCCTCGTCAATGGCCTC
TTCATGGTATATACCCATACCCCGTCGGTGCTGTCTTTTATCTTTGCTTCTCACGACTCGTACATTTCCGTGGCTGAGCACAAGGAGTCCATCACGAAGC
TGGAGCGTGTTGCCACCAGCGAAAATTGCGGGCACGAATAGGTTTCCGTCCTCGAACAAGATCGTTCCTGGAGGGTACACTACAACTTTGGCGTCTGATG
AAAGCATCCGCATCTCCTGAAAAGAAATTCCTCGCAGCCATGGTACACAACTGCAGGCTTTTCGGATAATCCTGTCTCGACACCGACCATGCCGCAGATG
AGTGCGTACAACGTCCATGTAAAGTTCCAGGTATCCGCAAACATCTTCTCTGAGCAGGGCTAACAGCTCGCAAGCGCTGGCAGCTCTTGCAGTTTCTGGA
TACTCGAGATCATCACTGTTAGGCGTCGAAGCCCATAGCTCAACGGGGTCGTTTAAGCTCACTTCTCCAAAGTACCCTCCAGTTGCTACTTGCTCAATCG
AAACTTGACTgacatcgtcttcctcgatAATATGGAGTGCTATCTCTCCACTGATTACGATGAACACGGCATTTGCTGTGTCACCTTTCTCGTAGATCAA
GTCACCTGGACCCAAATTCAACCTTTGGCCGCAACGCGCAACATTTGCAATGATCTTCAAGTCAGTGGCGATGGGTCTCAACCACGGCATGGTGCTCAAA
ATCTGGATGTGTTCTCGCTCttcgatggcagcgacgcTTTTCACGTCCGGTCCACTCGCATTTTTCGAGTAGATGACCTCCACCTCGCACCCACCACAAC
GGAAGACGCACCCTTCGGATAGGAGCAAAGGTTTGCTCGTGTGTTTCACTACATCGACTCCTTTCGTGTCCTCCGTGCCATCGGCTGCCATTTCGAGAAA
TGGTGGACCAGCTTCATCGCGGCCGATGAGAAAATATGTGCCAGCGTTGATTCCTGTGGGCTTCGGCGTGATCAAACACGTTCCGCGCTCAAGTTGCACG
CTAAACTGTTCGGTTGCTAAAGATGCGGTGAAGACTTGTGCATCGCAGTCTCTGCCTTTGCCAAATGTGACAGGTccaccgctgctgccaccccAGCCGC
TGCTTCCGCTGGATGCTCCGGAACCTGTGGACGAGTGCAATCGGAAGCCTACTGGCACGAATAAGCCCCGGATTCTCGTCTTTCGTTTCGACAATCGCAG
TACGTCCAAGCGCATGGCGGCCTCCTTCATATCGGGACGACGCTCAGAACCAAAggctcttgctgctgttgttaTGTACACTA