Description :
From Genome Similarity Track
Location :
Scaffold_39:372457- 375038
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011945Protein of unknown function

Sequence
2581 bases(100 bases per row)
TGCGCGGCAACGGGATTCGTTTCGTCCAGAAGTACAGCATGAGAGGACGAATTACTATGACGAGGACCAGGACATGGAATTGGATCGATTCAATAGCAGT
GAAACTCGATGTTCAGACGAAGATCGGAATTTGTATCGAAAACGGCAATATCAGCCCAGCAGAGATGATCTACAAGATGAACCGGTGTTTGTACGGCGAC
GCGTGGATGAAGCACCGCTGTCCTACGAGAGAAGTGGCATTCGAGATGCAAAAGAACCGTTGGTGCCACCTGTCAATCCGAATGTTCAGCAGGAGACGGC
CGAAAGTGAACCACTGTTTTACGTTGACAACGCCGGCGATCAAAAGCCCCATGCCGACCGGACATTAAAAGCCCTCACAGAAGAGCAAAGAATCAAGGCT
GAAATTGACGCTTATCATGAACTGATAAAGAAGATGTTTGAAGATCGAGATGATGTCATGACGCGATTGAACAAGATCGTCTGGGATGCTGCAAGAGAAT
ACACGTGGATTCAATTCTCTTCTAAGCTAGGCGTAAGTTTATATGCTTCAGCATGGCATACTTGTGTACCATGTGATTTGAGCAACCACAAAACTGACGA
TATGGCACTCGTTTTTGCCAAATAGGTTACCCAAGTCGTGAAGAAAGTTCCTGGCAAAGATTTGTTCTGGTGTGAGCTGCAAATTTTTGAAGGTTCTATG
CGTGTTCATTTCGAGGATAGAAGACTTGAGGTTGCGGGGCGACGAGCGACGGACGAGTTGAAGCAGATAATAGATCGAATATTCGTGGACTGGCAGCTGC
TGCTAAGAACGTACAGAGATCGTAGAAAGAACACACCGACGACTTTGATGGCAGGAAACGAGACGCGATCAAAGAACCAGCAATTCGTAAGTGGCCTGAC
AGCAATTTTTGAAAGTCTTTGTTGTGATGAGCATTATGTAACCATTGTTGTTGTTGCTCACAATAGGTCAAGTTAGTCGAGAAGCGCGCAGGGCATTTGC
GCGAATGCTATATCATTGTGCGAGACCAGTTGGCTATTCGCCACAAATGTTTGAATCAAAAGATGGCAAAGCGCTCTGCAAGTGAAGAGTTTCGTGATCT
TCTCGAATCGTTCTATGAGGTCACGGAACAGAAGATTAAGGCTGAAGTTGTGGCTTCGAATGCTAACAGATCAGCCGGTGGCAGTGCTCAACGAAGTACG
TCGAATGTCAGAGCCGAAGCTAGTCAACCACGCCAGCCTGCGCAAAAGAAGAAGGCAGCCAATCTTGTTCTATGCAGCGAAGACGAAGATGATGACGATG
AGTCGGACTACAGCTCAGATGATTCTGATTATGGGGGAGCACCAGCCACTGACAAAAGTGACAGCATTGATCGCACGAAAAGCCAGATGGATGCCACAGC
GATGAAATTGATGGATTTACTGGAAAAGGAGAAACGAATTCCATATGATGTGTCGTCAGAGAGCGTCAAGACGGACGATGCAAGACTCCGAGCCGTGATG
CGGAGTTTATTCACAATCAGCGATGATTTGTGCGCCGGGATTAGCAGCCTACGCGGTCATCTAAAGTTTGCCGGTTCTGCGGAGAAAGAGATCGTACAGA
ACGTGAAAGCAACGATTCACATGGAACGCCTTCAAGAAGGAATTCTGGAAGTTCGCGTTGCTGTGAACGACGTGATTCATTTCAAAGCAGCTGAGGCGAC
AAAACACGATGCTTGTAATGCAGCAATTGACGGCACGTTGAGGAAACTGAATGAAATCCGCAACGTTTGGGTTCAGCTGATCCATTTCTTCCACATGAAG
GAGCTTTCGGTTTCGAATATTACGGAATCCTTTCAAGCGCTGCGCCTCGCGAACATTGCACCAGTAAGCACTTCCTCCATCTCTGTCTCTCGTGCTTGAA
TCTCAGTGTCTTATTGCTTTCATTTCTGTGTACTGTTGTCTTATCTTACAGATTACCACCACAATCGAGAAACCGTCTTGGAGCCGCGATTACGGACATC
GGGCTTCATTGCATGCTCCTTCTCAGAGTGGAGTCCATTGTGTGCTTAGGATCGGAGACTATGTGGTGTACAGAGTTGTTGGTGACACTGAAGAAGAAGC
GAAAGCGTTGGCAGATTGTCGCACGGCCAAATACATTGCAAATCTGATTGACGCGGGTCTCGATCCTGAACCGATTGATGGCGAAGATGCAAAGATGCCC
ATTGATCTAGACGGAGGTGCAATGTTCCAGCCTGCAGCTCCACCGATCGACTGGTCCTGTCTTGCACGGATCGCTGACGTTGTGAACAGTGCGTCCTTTC
AGGACTTCCGCGTAGATGGAACTTGGTGTCTGCGAGAAACTTCGACGATCCCAACTGCTGAGGAGTTTCCAGTGGCAAATCTCGTAATCACGCAGTGCAA
AAAGATTCCAATCAAGGAGTTGGAGGACAAGCTTAGCAATTGGCATGAATCGACCGTAACGTTTTTCACTCTCGAGTCGGCATTTGAGCAATGGAAGTTT
GTGAGAGCGGTCGCTGCGTACGGTCACAAAGCGCCTTCGTTGGCATTCGCTCTTGAACTCAACATTACACCTGCGTGCAAT