Description :
From Genome Similarity Track
Location :
Scaffold_69:37242- 40647
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014667Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
3405 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNCCTCATCATCGTGTGCATCAGTGCACCACCGATGGCATATCGCTCGCATCGCAGACTACATGGAACGGCTCTCATGTCTG
CGAGAGCTAGGACAGGAGCTTCTCTTAAGCTCTTCTTTACTTCGGCAAACGCTGCCTGATGTTCCTCTGACCATTCCCACTCATTTTCTTTCTTCAAAAG
ACTCGTGAGGGGTTGCACTAACGCTGCGTAGTTGCGCGTGTATTTGTGCAAATAGTTGGCCAAACCCAACCACTGACGTAGCTGTTTGACGTTCTGAGGA
ATAGGCCAATCGTCAATAGACTTGACCTTCTCAGGATCGACCCGAACGCCATTCTTGCCAACAAAGCAACCGAGTACAGGGATCTCGGGGGCGAAGAAGA
TGCATTTCTTCAAGTTAGCGTACAATTTGTTCTCACGCATAACTTGAAAGACTTGACGAAGATGTCCAAGATGAACATCGACATCTTTCTTCCCTTCCGA
GGCCTTGCTGTGAACGAATATGTCGTCAAAGTAGCTCGGTGCAAACTCTCTTAATGGACGAAGTACATTCGTGACCATTCTGTTGAAAGTTGCTGGTGCG
TTCTTCAGACCTTGTGGCATCACCATCCACTCCCACAGCATACCACTAGGGGTGCTTACTGCTGTAAATGGTACATCACTCTCACGCATACGAATCTGAT
AGAATCCATCTTTCAGATCGATCGCGCTAAAGACAGTGCTGCCAACCATTCCATCAAGGATCATATCCTTTCGTGGAACTGGAGTCTGAGCAGGTATGGT
CGCATCATTCAATTTGTTGAATGCATGAACAATGCGCCAACCGCCTGTGGCCTTTTTAACACAAAAGGTGGGACTACAGTGCGGAGACTTGCTCTCGCGC
ACATGGCCAGCCTTCTGTCGCTGCGCGAAGAACTCATCGATCGCATCGACTTGTTCCTTCGGTAGCGGCCATTGCCTTGTGATACAGTACTTTATTCCCG
GAATTACATCTATCTCGTGACGAATGCCTCTATCCTGCGGCAATTCGTCCGGCACTTTGTCTGGAAATATGTCAGCATATTCCTTGACAAGTCCATACAC
GGGGTTTGTCTTTAGAGCGTCCCACGACTGCTCATCAAACCTTTCCTTCCGTGCCCTTTCATCTAACACTTCCGCAGTGTTGATAGCATCGCCGGCAACT
TCATCGACGATCACACAAATTTGCGAAATTTCGCCTTTCACCAGGCTACGCTTAAGCGTCTTCTTGCTCATCAACGGCAAGGAAATCAATTCTTGAGCCA
GACTTGGAGGATTTTCCACTTGCACATGACGCGCTATCTGGCAGTCACCTTCTTCATTGTAGACTACGACGTTCACGTATTCACTTGAAGTGGCTTGTTC
CTGCCTCTTCACTTCATCTTCTGCCTTCCTTGTGTCTTGATCAGGGACGCTTGCAGATCTTCGTTCTTCTTCATCGGTCTTCTTATCTTCTTTAATCCTG
TCAGAGCAAAACTCTTTATCGCTCTTGGCCACAGGAGTAGTCTTTTTCTGGCGCCTGACTACTCCACCTCCAGTGGTCTTCACGGGCTTGTCATTTGAGT
GTGAGGGGCCATCGCACGCCTGACTCTCATTAGACACATCTTCAACAGATGTATATGCCCAAATCACCTCTCTTGCTGTCAAGCAGCCGAGGTCTTCGTC
GACTTGCTTGTCGACGCTGATCTTCTTCTTCTTCCAGTCAATGCTCGGTTGGTACCTTCTCAACCAGGGCATTCCCAGAATCAGATCAAACTTGTCATCG
AGGTCGAGTGCTATAAACTCGTCTTCACCTCGGAAATCATCACATTCGATTGCCATACGCAACACGCGCTTAGGCATCGTCACTTTCGACCCATTCGCCA
AGCGAACGATCATTTCCTTGTTCGAGATAGGCAGGTCCAAACCTTGCCTTCTCACCACTTGTGTGCGGACAAAATTGTTCGACGCACCAGTGTCTACAAG
AGCCCGTAGAGGTTCTGAGTAACCATCTACCTTAACCTTGTGGACTATCAAGGTTGGCTCTTGCTCGACACGCTCACATCTGTTCGCGGAAACTTCATGT
GCGTTACACACACCGGGGCAAGAGTTCTGCGCTTCCACGACATTCACAGAACTCTTAGTTCGCCCAGTAGGGAGCCCCGCTCCTACTGGTCGTTCCCGTT
TTTTGGCTGTTGGGAACGCTCAAATTGTCGGCCTCTGCTGGTCGATTCGATCGCGGACCGTGCGTCGCTTGCTGGCTTGGCAAGGACACCTTGCATTTCT
CGCGATGTGGCCGGGTTGCCGCAACGGAAACACTTCCCGTCATTGCGTGGCTGTCGACTTGCAGTCACATCGGCATACGAGATGTCCATTGGCTCTGGGC
CATTGTATGTTGTCGCTTGTTGTCTTGGAGGTCGAGCGACAAAACCGCCGAACTTGGCTTGCTTGATGCTGAATTCTTCTTGCATCGCTCGCTCGATAGC
TTCATCCAGCGTCTTGGGGTACTCGCGGAACAACTGGTTCCGAATTGGACCATCATTGAGCCCTGCCATGAATGTCACAACTTGTGTTGAGGCATCAATC
GGCTCATTCACGATACTTGACACAAGGTATCGTGCTCGTTGAGCGTACGAGTGTAGGTCGTATTTACCCTGACGAAGCTTTAAGAACTCTGCGCGAGCCC
GAAATTCGCTCTGCGGAGGTTCAAAAGCCTTCTTCAGCTCTCGCTTGAAGTCGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATCGCTTCCCATACGC
CCAACTTTTCGCTCGACCCGCAAGTTTTGACATTGCAAACAACACTTGCTGTATTGGGTCCCGTAGTTGTCTTGCAGTGATCGCTGCATCCAACTCAACG
AACCATCTCGCTAGAGGCTCGTTCTCTCCGCCACGGTACGGAGATACATCGAGCTTCAGAGGTGCTACTCTCATCGTCGTGACAGGAGTTGCAGACTGTC
GATGAGAGTTCATGATCTCGTGATGCATGAAGCTCGTAGCCGCGTTCCTCTGCTCATCCGGTGACGCTGATTTCAGCAAGCTGATCACAGCCGCCTCACC
GATGACCGCTCGCATACGCTCGAGGGCTGCCCACTCGTGGCTCGACAAATGAGGAAAATGCTCATTCGTCAGCTCCACGGTTTCTCCAGGCATCGAGCCC
ATCGGCGTCTCAATTCCTTCCATTGTTTCTCACAATCGGATAGGGGTCTTGGAATGTCTGCGCATGCTACACAAGCGGCCTATGCAGACTCTTGACTTGG
TCGTTGGAAGGACTACGAAGTGCTACCAGGTGTAAGAGGCTATCCAAGACAGCCTCAAACACAGCACGCACGCTTGCACTTGAGAGGAAGACTTGAGAGG
AACTT