Description :
From Genome Similarity Track
Location :
scaffold_184:37235- 38533
Transcript NameFunction/comments
g5279.t1 hypothetical protein PHYSODRAFT_552600
g5280.t1 hypothetical protein PHYSODRAFT_340045

Sequence
1298 bases(100 bases per row)
GTCGTACTCGGCCAGGATCTCCTCAGCCGACTTGCCCGTCGTCTCCGGCACCAGCTTGAGTCCGAGTAGGAAGAAAATGGCCAGCAGCACCACGAACGGC
ACGTACGCGTAGTCGTTGAGCGCGTCCGAGATGTACGGGTAGGCGACGCCGACGATGAGATTGCAGAGCCAGTTGCAGCCGATACAGAGCGACGTGGCCG
AAGCGCGGATGGAGTCCGGGAAGATGTCGGCCGTCATGACGTACACGAGCGGCCCCAGAGTCACACCGAACGCGACGACGTACAGCGCCGTGAAGACGAT
GGAGAGCGCCGAGATGTTAACGAGGAAGCCGACGGTCATGAGAACGGACATGACGAACATACCGGCGAGATCATGTTACGAGCACCGAAGCGGTTGGCCA
ACACACCCGTGAAGAAGGCGGGCCAAATGTTGATGAAGTCGATGATGAGCGTTCCGATGTGCGAGTCGGAGATACCTGCCGACTTGAAGATAGATCCGGA
ATAGTAGAACACGGCGTTAATACCGGACAACTGCTGCGCGCACGAGAGCATGATGCCACAGGCGAGTTGCATGCGGTGGCGAGGGTTAAACATGGAGTCC
TTCTCGGTGGACGTGTCGTTCTCGACGTTGTCCGGGTTCCGGTTCACCTTGAGCCATGAGAGAGCGGTCTCGACGTGCTCTTCACCGTACAGACGAGCGA
GTACTTGACGGGCTTCTTCAGTACGGCCCTTAGTCAACAGCCAAGCCGGACTCTCGATGCAAAACTTGGGAGCTAACAGCAGGTAAATGACGGCCAATAC
ACAAGGAAAAGCAGCCAGATAACGCCACCCGGAGCTCGTGTTAGCGAAGAAAAAGGTGATGGCTGGGAACAAGATACCGATGGTAGTGAAGATCTGTAGA
CCCAAGCCCAGCGTGTTTCGCATGTGAGGAGGGGTCAATTCGTTCACATAAGCACCGATTGTACCCGTAGCCGTTCCTGAAGCAAGACCAGAGATTAAAC
GGCCGGCGGCAAAAGCCCAAATGTTGGAGACGGAGGCCTGAATGACACCGCCCACGAACATGAAGATGCAGTTGCTCATTAAAGCCTTCTTACGACCGAA
TTTATCGGCGAAATGGCCGCAACACAGTGAGCCGATCATGGCGCCGAAGATCCACGCGTTCACGGCGAATGTCCACCCGACCTTGGAGTGACCCGGGAAC
ATGAGGCACGTGCCGTCCGCCACGGGACGCGCGTCACACTGATCTTCGTCGTTGTACTGGGAGAGATTGGTCTGCGACGTCGACCAACCGGACTGGAA