Description :
From Genome Similarity Track
Location :
Scaffold_996:3723- 5704
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_996-fgenesh-gene-0.0Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP43
Pytiw_DAOMBR242034maker-piw_contig_996-snap-gene-0.6DEAD/DEAH box RNA helicase

Sequence
1981 bases(100 bases per row)
CCACCAGCAGCAGTGGCAGCGGCAGCGTCAACCCGCTCACGGGCAAGACGTACTCGGCGCACTATCAGAAGCTGCTCGCGCAGCGCCAGAAACTCCCTGT
CTACGGCTTCCTGAACGAGATCCAGGACGCGATCAAGACACACCAGGTGATCGTGATCGAGGGCGAGACCGGCAGCGGCAAGACGACGCAGATCCCGCAG
TTCCTGACCAACATGGAGATCCCGGGCGCGGCGCCCGGCGCCAAGATGGTCGCGTGCACGCAGCCCCGTCGAGTGGCCGCCATGAGCATCGCCAAGCGTG
TGGCGGAGGAGATGGATGTGGAGCTCGGCCAGGAGGTCGGGTACACGATCCGATTCGAGGACGTGACGTCTGCGAAGACCAAGCTACGCTTCCTCACGGA
CGGTATGCTGCTGCAGCACGCCATGAGCGACCCGCTGCTGTCGCAATACTCGGTTATCCTGCTCGACGAGGCCCACGAGCGCACGCTCAGCACCGACATC
CTCTTCGGTCTGCTCAAGGAGGTGATGCCGCGCCGCCCGGACCTCAAGGTCGTGGTCATGAGTGCGACGCTCGACGCCAAGAAATTCCAGGCGTACTTTG
AAGGTGCGCCGCTGATCGCTATCCCGGGCCGCACGTTCCCCGTCGACATTTTCTTCACACCGTCCCCAGAACGCGATTACCTGGAGGCCGCCGTGCGCAC
GGCCGTGCAGATCCACATCTGCGAGGACGAGGGCGACATCCTGCTCTTCCTCACGGGCCAGATGGAGATCGAGAAGGCCTGTGCGCAGATCCAGGGCGAG
GCCGACGCGCTCGACCCGGCAAAGCACGGCCCACTCGCTGTCTACCCGCTGTACTCGACGCTACCGCCCAACCAGCAGCAGCTCATCTTCAAGGACGCGC
CAAAGCCGCGCTTCCCAGGAGGCCCACCCGGTCGCAAGATCGTGGTGTCGACCAACATTGCCGAGACGTCGCTGACGATCGACGGCATTGTGTACGTGAT
TGACCCGGGCTTCTCCAAGCAGAAGGTGTACAACCCGCGCATCCGTGTCGAGTCGCTGCTCGTGTCACCAATCTCGCGCGCGTCGGCCAAGCAACGGTCC
GGGCGTGCCGGGCGTACGCGCCCGGGCAAGTGCTTCCGCCTGTACACGGAACAGTCGTTCCTGCGCGACCTGGAGGAGCAGACGTACCCAGAGATCCTGT
GTTCCGAGATGAGTGGCGTCGTGCTCACGCTCAAGCAGCTCGGCATCGACGACCTTGTCCACTTCGACTTCATGGACCCACCTGCACCCGAGACGCTCAT
GCGAGCGCTCGAGATGCTCAACTACCTGGGCGCGCTGGATGATGAAGGCGACTTAACACCCATGGGCAAGATCATGGCGATGCTGCCAGTTCACCCGCAG
TTGGCCAAGATGCTCATCTCGTCGGCAGAGTACAAGGTCCCACAGGAGGTGGCGACGCTCGTGGCCATGCTGTCGAGTCCCGAGCCGTTCGTGCGTCCCA
AGAACGATGGCAAGGCCGCGGATGAGGCCAAGGCCAACTTCTCCCACGTGGACGGTGACCACCTGACGCTGCTCAACGTCTTCCACGCGTACAAGCTCAA
CAACAGTGACGCGAACTGGTGCTACGAGAACTTCCTGAACCACCGGTCGCTGGCATCGGCGTCTAACGTGCGCGATCAGCTCATCCGCAACATGAAGCGC
CTTGAGATGCCGACGCAGTCGACGCTGGACATTAGCTCGCCGGACTACTACGGCAACATTATTCAGTCGCTCGTCTCGGGCTTCTTCATGCAGGTGGGCT
TCAAGGCCAGCGGCGGTCACTACGTCACGGCCAAGGACAACCAGGTCGTGCACCTCCATCCGTCGTGCGTGCTGGACGACAAGCCCGAGTGGGTGCTCTA
CAACGAGTTCGTGCTCACAAGTCGCAACTACATCCGGCTCAACACGCGCATCCGCGGCGAGTGGCTCGTCAACCTGGCTCC