Description :
From Genome Similarity Track
Location :
Scaffold_166:37224- 38778
Transcript NameFunction/comments
g6499.t1OWZ02986.1 hypothetical protein PHMEG_00025358 [Phytophthora megakarya

Sequence
1554 bases(100 bases per row)
CAGCAAGAACGTCGACGGGATGTAGAAGGACTGTGCCACAGGACCACAAGCACGTTAGCTGGGAATCACTACAATGGTCAGACAGTCGCCAATATACCTG
CTGAATCAACGCCAGCCAGAGCATGGTCAAAATGACGCTAGCCAGTGCGAAGTAGTGCACGATGACGAACACATTGAGCCCCTTCAGCTGGCGCACGGTC
AGGAACACGAAAACCTGGCTCACAGCTCCCAGCAACCCCGAGCAAACTGCAATCCACGACCCGTCCGTCGCAGCCGTGGGGTGGTTGTAGCCAAAGATGA
TGCCCGGCCGTACGACGCAAATGAGGCCGCCGAACGCCACGAACGCGCACAGAAGACTCACGGGATCAATCTTCTCGTGCAGGAAGAGCGCGCCCTAACC
AAACCCAACCAAGCAAGAACGCAACACCGTCAGCACCAGCAACAATTCGCGCTCCAGCTCAGCCCAAGACTCGCAACGTACAAAGAAGAAAGTAAGCATT
GGAGAGGTGAACACGATCGAGCTTGCGTCCGCCAGCACCATTTGCGACATGGCGTAGAAGGCGAACCCCATGCACGCGAAGCCCGCGATGCAGCGGTACA
GCAGCATCTTGCGGTATTCCTGCGGTACGTCTAGACTGGTCCCCGACACCTTCACGACAACCTACGCCAGCCACAAATATAGTCAGTCGCTGCACTACTA
GAAGAGCAAACCGTTGGCCCCGACTACCAACTCAGCAGCTTCCGATTGCTCCATCAACGTACGTAGTTGCACACGAGCACGCCGACCGAGCGCCAGAACG
TGGCCTCCATGGACGAGAAGGTGAAGGTCATGTACTTGATGAACGTGGACATGAAGCTGAAGCACAGCGACGCCAGCGCCACGCATGTGATGCCCAGCAG
TGCGTGGTGACTGGGCTCAGCGTCCGTCTTGGCAGCCACCGCATCCGTGGACGACGTGGGCAGCAGCGGCGCCGCCTCGCTTGACTTCTTCACACTCATC
ACTGTTCGAGCTGCGTGTTGCTGAGTGAGCTCCTGGTCTCAGGAGAGACCTTTGACACTCATCACCCTGTAAAACGTACTTAACATAGATAAGCGTGGTG
TGCTCCACGCAAACTGAAGTTGAAGTGTGATCATCTAAATCTCCTACAAGTAACAGAGTAACCTGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGGG
TAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGG
CTATATAGTGGAGACTCTGCGCGATTGGCTGTTATAATGCGTAGTGTGGACTACACCACATCGGAAGTAGCCGAATAAAATCACTGATGCTGATTGGACA
AAATAAACCGCCTTTAACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGGGAGATTCCAGGCAAATTCTGCAGGTGGTGAAGGGCGGATCGGC
TACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCA