Description :
From Genome Similarity Track
Location :
contig_49:372238- 377284
Transcript NameFunction/comments
g9756.t1hypothetical protein
g9757.t1XP_009524320.1 hypothetical protein PHYSODRAFT_497048 [Phytophthora sojae

Sequence
5046 bases(100 bases per row)
CGCTCCCGCAGCTCCCGAAGGAACGCGTCGTACTTCCTGCGCAAAAGCTGCATGGCAAGCTTCTCGTACGTCGCGCTGTCGAGGTCTTCGTCCAAGGTGT
GGTTCAGCTCCCAATTGATCTTCCCATCCGCCGCGGCTGCATCTCGGACGATGCGGTAGCGCGCTGATCGCTTTTGCAGCAGGAGAAACTTGGGGAGCTC
CTCTGTGCACGTGGGCCACACCTCCTGCAACGTCGGCACCACTTGCGTGTCGTCCTTGAACTTCTTCGGCGAGACTGCCACACAGCGGATGAGGTTGTTG
GCACAGCGCTCAAACGCCTGGAAGAACGGCGTCGTGGCAGCGAACCGCCCAGCCTTCTTCGCGCCAAACCTCCAGACGTCCTGGTCCAGCGCGTGCGGGT
CAAAGGCGTCTTCGACTACGCTCTCGTGCGTGTACCCGACCATACGCTCCACCAGCGCCAGGTATCGAGCCTCATTGAATCTGATGAACTTGTGTACACG
CGTAGCCAGCAGCTCCTTCAGCACTGCCAGCAGGGCCTCGCCGTCGTACTTCTCTTGCGAACGACGAAGCAGGAAGAACAGCAGCTTCCCCACAGCGTCT
TCCGGGTTGACCGGCATCTTCGGCAGGGGCTTGACACTGGTCATGACGAGACGGATCGAGTGCACGAGCTTGGCCACGAGTTCCCACTGGAAATCGCTCA
AGGGTTCGTCTCGCTGCTCGAGCAGGGCCATCAGCGAAGCCGACACGGTGCCACGAAACATGTTGGGGCAGAAGAGACCGGCAGGAGCACCCGACAGCAG
CCCCGTCAGGATGTCAAGCACCTGCGTGCCTGACGCTGCGCGCACTAGAGCGCTACCCAGCGCATCGTCCGGGTCAGCGACCATTTGTGCGTAGTTGTAG
TCCCGGGCTCGAATGCTCAGGCCTCCGGTGGCTTCCTCGCTGCCGATGAGTGTCAGGAAGTCGCGCGCTGTGACTACGTCCGGGGAGACCTTGGTGATGA
CGGCCGACCACGCGTCCATGAAGTCCGGCTTGCCGTTCTTCTCCGGGAGCTGCAGCACGGCGAGGTGGGCCAGGAACAAGCTTGCCACTGTCTGCAGAAC
CGTCTTCGGGTCGAAGACGTCGTCTTCCTCCAGCGCATCTTCTGTCGCCTCTTGTGTCGTGAGCAGTGTGATAGCACTGATGGACGCCTCTAGCTCGCTG
GCTGTGGTGATCTTTTGCTGCAGCACACCAGGCAGCGACTCGGCGGTGAGCTTCAGGTGGTTCTGGTTCTCGTCAGGCAGCAAGTCGCGAATCTTCTCGA
CGAGGGATGTGGCGCGATCCAGGGCGTCGTTGTAGCCGAGCTTGCCCGTGAGGCACTGTGCGATGGTGATCAACAACTCAACCTGCTCGCGCAAGCCTGA
CGCTGCGATTGCACGCTTGGCGAACCGATCACCAACCACGACTGTAGCTCGGTCAAGGAAGGCGAAGAGCACGTCGCGCGTGTCTCCTGCCACCGGGATC
GCGTTGTTCTTGACGTCTGCCTCGCAAGACGGAACGCTGAAGCCTTCCAGGTCGTAGAAGATGAACGTGTCCAAGCTCGTCTCGCTGGGAGCCTCTTCCT
CAGTGGCAACCTCGAAAGTCCCCCCTGCGCAGCGATCGAACATCTTGGAGAGGATGACCATAAGCCCTGCCGCTAGCTGCGTGGCGGCGCGCACCTTGGG
CTCGATGAGCACTCCGTCGAACGTTTTGGCGATGCTCCCGTACATCCTGTGGTCGCTGTTCTTGACGTACTTGACGACGTTTACGATGAGGTTCCCCTCA
AAGTGCGCCTGCACCAAGGCGAGCACGTTGAACATGTCCGAGTCCACGATCGAGTGCTTCTCCTTGAGGAAGTTAATCTCGTGCTCCGCTTCGCACGTTC
TGGTTTCCGCGAGGAGGTGCGGGCCTGCGTCTGTGATCAGGAAGGCGATCGTGGGCATGGTGCTGTCCAGCGTCAGCAGCTCTGCGAATGCTGCCTTCTG
GTTCTCATCGCCGTCTCCGCCGTTGGCACTCACACTCGGGTGGCCAGGAGGGACGCACAGCTTCACGGAGGTGATGAAGTCCATCGCCTCTTCCCCTTCC
GTAAAGCTGTGGTTCGTCACGAAGCAGCCTTGCGAGCTCTCCGTAAACGTGATGATGGTGATCATGACAGCGTACTCCTCTTCAAACACCGAAGCAACGA
GGTGGCGCACAGTCTCCTTCACGCCTTCCAGCTCGCTGCCCATGGAGCCAGTGATGTCGAGCAGGAACACGAGGTTGATCATGATCTCCGCGAAGTGGTG
GGCCTTGAGGTGAAGTGGCTGGTTGCTCGGAATCAAGTTGGAGAATGGTCAGTGTCGGCAAGTCCGAAGGTGGGTGGAAAACATGTGAGGCCAGATAGAG
TGAGTGAAGGTCAACTTCAACTTGTACCACAATATTTTCGTGAGTGAGGGTTAACTTCAACTTGTACCATAAATGTGGACCATACGTGATGCGTTTGTGG
TGAGCGCAGGTAGCTGGAATTGGAGGCTACGAGGTTCGACCACAGATATACTGAGCATACTTTGCTATATTTGTGAAGCACCAAGGCAACTGGTTTTGTA
TGTCAGCATTTCCCATCATTCAGACAACCAAAGCTATGCCGGTTTAATGACTTGAGTAAACAGTGACTGTGAAAATGTCAAGTGTCTGGGATACTTGGTC
CTCGTTTGAGGGGCGAAGTCACTCGATGACTCAACTACAGCTAGCGATTTTCAACCTTCCTTATTCACCTCCCGCCCAAACTATCCTTGCCTGGCTGTCT
GCCCCTCCTTGTTCTTGTTGGGCTTATCTTCCTTGTCATCCTCTTCGGCAATCGGCTGGTTCGTCGAAAGGTATACCTGTCGGATAATACGCGGGGCCGC
AAACAAAAAGATATCCGACAGCACGCGCTGCTCGATCACCCCAGCGGCACAAACCCTACGGACTTCTTCCACCTTCTCTTCTCTTGCTCTTGCATGAACA
TTCTGGGAGAGTGGAGCACACTCAGGAATGCAGCTTTGCACTTCATGAGTAAGGGTTGGCATTGTCGATAAATGGGTTGGTTGTGAAATTTCCTACATTC
TTTACAGAATTTGGAATACGGTGACTTCATCCCGATATATTCCAGTCCTCCGGCATCTTCACAATTGCATCCACGTAGTACTCAAAGTTAGGAGCAGTGC
CAGCTAAAAAGATAGCTGCGGGAACCATGCGCCTTAGCAAACATACACGTAGGCGTCGAGCACATTTCGTGAGTGGATTGTTTGGGTCGCACAAAGCCTT
TGCGAGCTCCGCGGCATCGTACCATGGGATATCTAACTCTTCTGGGTATTCAGTTGTCAGCACGAACGTAACTGTGCGCATGTCTGAAGTGTTCAACCTG
CCAAGGCTAGTAGTAGCAGACCTTCAACAGAAGAGCGCATACGTGCTCGTTTCAAAAAGAAATCGTAAGCCAGCCACATCCACCAGTGATCTCGGTTAGT
AAGATCCCGAGCATAAATCCCCAATTCTAGCGACAACTTGGTTACATACTGCGTGTGTCCTACGGCGGAGCACATGGCCTCGAAATCGATGGCTGGCATC
ATCTCTTCGCATATCAATTCGAGCAATCCTGGATCTTGGTCCGATCCTTTGACACCAAATGCGGAGTTAACATGTTGATTTCGACGCGTACTGTCAAAGA
TCCGTCTCAGGAGCTGCCCGAGGGATTTTCTTGCTGTGAACTTGTTGTTCGTGCCCTCACGCTGAATCGACATGACAAGTGTCAGGAGTGAAAACTGCAT
AACGTGGTTCTCAACTAGACTGTCCATCACTTCTGGAGTCCAACAGATACCCTGAAGATCTACCGATGTCGACTCGGTTACAAAAGTACATCTGATTGCT
CCACTCTCCAAATCCTCTGGGTAGTACGTATTTCACTGCTCTTGAGCTTCCTTTTCAGCTCCGACAATATCCACTATTTCGCCAAGAGAGGTTGGAATCG
ACTCCGATTTAGTGTACAGGTCCAATTTCACAGGAATTTTGATTTCTACTCCAGGTTCCCCAGGATTCACGTTATCATCCAGTGCTGCAATCCGGTCCAG
TGCCTTCAGATACTCCTTGCTCTGGTGTTTTCGTTGATGCGTTCCGCAGAAACGCACGGAGTCGTAATCGATCTTACCGTTCTCGTGCACATGTCCCTTC
ACGTCCACGTCTAGCGAAAACTTCACTACATTGTGGCTTCAAACAATTCATCTCCGTATTTCCCGAGCTTGACTCCACAATGCTGAGTTAGGAGATACCG
CCACGCTCGATAGTCTGCGTGTTCTACTGCTGCCATCAGCTCCAGAGCTTCTCGGATTTCATGAAACTCTTTTCATCTTTCTCCTCTTGAAAACTGAGCT
CATCTTTCTCCTCTCGGCGTCTCGGCATGGTCACTTGTAGTACAATTGCATCCATCCCCACACACATACTCAGTGGATTTAGGGTCGGAATATCGGTGTG
AGGCTTCAACACCTCACACCATGGAGCGAGCAAGCCCCAACGCTCGTCCATTCTCGAGATCGACAGTCCAAACAGGAAATGGTCGGTAGTTTTGTGCCAA
CGCGTTGTTTCCTATCTCAGTACATATAATTAGACTTCGTAACGAAGTTTGTGTCGGCTTCAACAGCAGCAATCGACGACAATGTCTTCGGATGTTCTAG
TGGAGCGCACGTACCAGGCGCTCATGGGCGTCGTGCAGACGACTGCCGTGAGTCGAAAAGTGCTTGCGAGGCCTCCGTTCACATTTCTCCACAAACTGCT
GCTAGAAACTTTGAGCGAGTTCGACCTCTTCTCGGAGCAGCAAATGGACTTTTCTACCCTGACCACGAAGCAAGCCAAGGTACCTACCACCTGCCAACAG
AGCAAATGTACTTTGTATCACTCACAATTCCACCCGATTTCCGTCACGTCGTAGGCTGCTTTCTTGACACGTGCGATCGCATTCGTGACGTTCGTGCTGA
GCGCGCATTCTGATCGGCACCACATCTCCTGTCTTTTGCTCGTGAG