Description :
From Genome Similarity Track
Location :
contig_49:372203- 377249
Transcript NameFunction/comments
g10219.t1OWZ14526.1 hypothetical protein PHMEG_00011986 [Phytophthora megakarya
g10220.t1XP_009524320.1 hypothetical protein PHYSODRAFT_497048 [Phytophthora sojae

Sequence
5046 bases(100 bases per row)
GCTCCCGAAGGAACGCGTCGTACTTCCTGCGCAAAAGCTGCATGGCAAGCTTCTCGTACGTCGCGCTGTCGAGGTCTTCGTCCAAGGTGTGGTTCAGCTC
CCAATTGATCTTCCCATCCGCCGCGGCTGCATCTCGGACGATGCGGTAGCGCGCTGATCGCTTTTGCAGCAGGAGAAACTTGGGGAGCTCCTCTGTGCAC
GTGGGCCACACCTCCTGCAACGTCGGCACCACTTGCGTGTCGTCCTTGAACTTCTTCGGCGAGACTGCCACACAGCGGATGAGGTTGTTGGCACAGCGCT
CAAACGCCTGGAAGAACGGCGTCGTGGCAGCGAACCGCCCAGCCTTCTTCGCGCCAAACCTCCAGACGTCCTGGTCCAGCGCGTGCGGGTCAAAGGCGTC
TTCGACTACGCTCTCGTGCGTGTACCCGACCATACGCTCCACCAGCGCCAGGTATCGAGCCTCATTGAATCTGATGAACTTGTGTACACGCGTAGCCAGC
AGCTCCTTCAGCACTGCCAGCAGGGCCTCGCCGTCGTACTTCTCTTGCGAACGACGAAGCAGGAAGAACAGCAGCTTCCCCACAGCGTCTTCCGGGTTGA
CCGGCATCTTCGGCAGGGGCTTGACACTGGTCATGACGAGACGGATCGAGTGCACGAGCTTGGCCACGAGTTCCCACTGGAAATCGCTCAAGGGTTCGTC
TCGCTGCTCGAGCAGGGCCATCAGCGAAGCCGACACGGTGCCACGAAACATGTTGGGGCAGAAGAGACCTGCAGGAGCACCCGACAGCAGCCCCGTCAGG
ATGTCAAGCACCTGCGTGCCTGACGCTGCGCGCACTAGAGCGCTACCCAGCGCATCGTCCGGGTCAGCGACCATTTGTGCGTAGTTGTAGTCCCGGGCTC
GAATGCTCAGGCCTCCGGTGGCTTCCTCGCTGCCGATGAGTGTCAGGAAGTCGCGCGCTGTGACTACGTCCGGGGAGACCTTGGTGATGACGGCCGACCA
CGCGTCCATGAAGTCCGGCTTGCCGTTCTTCTCCGGGAGCTGCAGCACGGCGAGGTGGGCTAGGAACAAGCTTGCCACTGTCTGCAGAACCGTCTTCGGG
TCGAAGACGTCGTCTTCCTCCAGCGCATCTTCTGTCGCCTCTTGTGTCGTGAGCAGTGTGATAGCACTGATGGACGCCTCTAGCTCGCTGGACGTGGTGA
TCTTTTGCTGCAGCACACCAGGCAGCGACTCGGCGGTGAGCTTCAGGTGGTTCTGGTTCTCGTCAGGCAGCAAGTCGCGAATCTTCTCGACGAGAGATGT
GGCGCGATCCAGGGCGTCGTTGTAGCCGAGCTTGCCCGTGAGGCACTGTGCGATGGTGATCAACAACTCAACCTGCTCGCGCAAGCCTGACGCTGCGATT
GCACGCTTGGCGAACCGATCACCAACCACGACTGTAGCTCGGTCAAGGAAGGCGAAGAGCACGTCGCGCGTGTCTCCTGCCACCGGGATCGCGTTGTTCT
TGACGTCTGCCTCGCAAGACGGAACGCTGAAGCCTTCCAGGTCGTAGAAGATGAACGTGTTCAAGCTCGTCTCGCTGGGAGCCTCTTCCTCAGTGGCAAC
TGCGAAAGTCCCCCCTGCGCAGCGATCGAACATCTTGGAGAGGATGACCATAAGCCCTGTCGCTAGCTGCGTGGCGGCGCGCACCTTGGGCTCAATGAGC
ACTCCGTCGAACTTTTTGGCGATGCTCCCGTACATCCGGTGGTCGCTGTTCTTGACGTACTTGACGACGTTTACGATGAGGTTCCCCTCAAAGTGCGCCT
GCACCAAGGCGAGCACGTTGAACATGTCCGAGTCCACGATCGAGTGCTTCTCCTTGAGGAAGTTAATCTCGTGCTCCGCTTCGCGCGTTCTGGTTTCCGC
GAGGAGATGCGGGCCTGCGTCTGTGATCAGGAAGGCGATCGTGGGCATGGTGCTGTCCAGCGTCAGCAGCTCTGCGAACGCTGCCTTCTGGTTTTCATCG
CCGTCTCCGCCGTTGGCACTCACACTCGGGTGGCCAGGAGGGACGCACAGCTTCACGGAGGTGATGAAGTCCATCGCCTCTTCCCCTTCCGTGAAGCTGT
GGTTCGTCACGAAGCAGCCTTGCGAGCTCTCCGTGAATGTGATGATGGTGATCATGACGGCGTACTCCTCTTCAAACACCGAAGCAACGAGGTGGCGCAC
AGTCTCCTTCACGCCTTCCAGCTCGCTGCCCATGGAGCCAGTGATGTCGAGCAGGAACACGAGGTTGATCATGATCTCCGCGAAGTGGTGGGCCTTGAGG
TGAAGTGGCTGGTTGCTCGGAAGCAGGTTGGAGAATGGTCAGTGTCGGCAAGTCGAAGGTGGGTGGAAATCATGTGAGACCAGATACAGTGAGTGAAGGT
CAACTTCAACTTGTACCACAATATTTTCGTGAGTGAGGGTTAACTTCAACTTGTACCATAAATGTGGACCATACGTGGGGCGTTTGTGGTGAGCGCAGGT
AGCTGGAATTCGAGGCTACGAGGTCCGACCACAGATATACTGAGCATACTTTGCTATATTTGTGAAGAACCAAGGCAACTGGTTTTGTATGTCAGCATTC
TCCATCATTCAGACAACCAAAGCTATGCCGGTTTAATGACTTGAGTAAACAGTGTCTGTGAAAATGTCAAGTGTCTGGGATACTTGGTCCTCGTTTGAGG
GGCGAAGTCACTCGATGACTCAACTACAGCTAGCGATTTTCATCCTTCCTTATTCACCTCCCGTCCAAACTATCCTTGCCTGGCTGTCTGCCCCTCCTTG
TTCTTGTTGGGCTTGTCTCCTTGTCATCCTCTTCGGCAATCGGCTGGTTCGACGAAAAGTATACCTGTCGGATAATACGCGGGGCCGCAAACAAAAAGAT
ATCCGACAGCACGCGCTGCTCGATCACTCCAGCGGCACAAACCCTACGGACTTCTTCCACCTTCTCTTCTCTTGCTCTTGCATGAACATTCTGGGAGAGT
GGAGCACACTCAGGAATGCAGCTTTGCACTTCATGAGTAAGGGTTGGCATTGTCGATAAATGGGTTGGTTGTGAAATTTCCTAAATTCTTTGCAGAATTT
GGAATACGGTGACTTCATCCCGATATATCCCAGTCCTCCAGCATCTTCACACTTGCATCCACGTAGTACTCAAAGTTAGGAGCAGTGCCAGCTAAAAAGA
TGACCACGGGAACCATGCGCCTTAGCAAACATACACGTAGGCGTCGAGCACATTTCGTGAGTGGATTGTTTGGGTCGCACAAAGCCATTGCAAGCTCCGC
GACATCGTACCATTGGATATCTAACTCTTCTGGGTATTCAGTTGTCAGCACGGATGTAAATGCGCGCATGTCTGAAGTGTTCAACCTGCCAAGGCTAAGC
AGTAGCAAACCTTCAACAGAAGAGCGCATACGTGCTCGTTTCGAACAGAAATCGTAAGCCAGCCACATCCACCAGTGATCTCGGTTAGTAGGATCCTGAG
CATAAATCCCCAATTCCAGCGACAACTTGGTTACATCCTGCGTGTGTTCAACGGCGGAGCACATGGCCTCGAAATCGATGGCTGGCATCATCTCTTCGCA
TATCAATTCGAGCAATCCTGGATCTTGGTCCGATACTTTGACACCAAATGCGGAGTTAACACGTTGATTTCGACGCGTACTGTCAAAGAGCCATCTCAGG
AGCTGCCCGAGGGATTTTCTTGCTGTGAACTTGTTGTCCGTGCCCTCACGCTGAATAGACATGAAAGGTGTCAGGAGTGAAAACTGCATAACGTGGTTCT
CAACTAGACAGCTCACCACTTCTGGAGTCCAACAAATACCCTGAAGATCGACCGATGTCGACTCAGTTACAAAAGTACATCTGATAGCTCCACTCTCCAA
ATCTTCTGGGTAGTACGTCTTCCACTGCTCTTGAGCTTCCTTTTCAGCTCCGACAATATCCACTATTTCGCCAAGAGAGGTTGGAATCGACTCCGATTTA
GTGTACAGGTCCAATTTCACAGGAATTTTGATTTCTACTCCAGGTTCCCCAAGATTCGCATTATCATCCAGTGCTGCAATCCAGTCCAGTGCCTTCAGAT
ACTCCTTGCTTGAGTGTTCTCGCTGATGCGTCCCGCAGAAACGCACGGAGTCGTAATCGATCTTACCGTTCTCGTGCACATGTCCCTTCACGTCCACGTC
TAGCGAAAACTTCACTACAATTGTGGCTTCAAACAATTCATCTCCGTATTTCCCGAGCTTGACTCCACAATGCTGAGTTAGGAGATACCGCCACGCTCGA
TAGTCTGCGTGTTCTACTGCTGCCATCAGCGCCAGAGCTTCTCGGATTTCATGAAACTCTTTTCATCTTTCTCCTCTTGAAAACTGAGCTCATCTTTCTC
CTCTCAGCGTCTCGGCATGGTCACTTGTAGTACAATTGCATCCATCCCCACACACATACTCAGTGGATTTAGGGTCGGAATATCGGTGTGAGGCTTCAAC
ACCTCACACCATGGAGCGAGAAAGCCCCAACGCTCGTCCATTCTCGAGATCGACAGTCCAAACAGGAAATGGTCGGTGGTTTTGTGCCAACGCGTTGTTT
CCTATCTCAGTACATATAATTAGACTTCGTAACGAAGTTTGTGTCGGCTTCAACAGCAGCAATCGACGACAATGTCTTCGGATGTTCTAGTGGAGCGCAC
GTACCAGGCGCTCATGGGCGTCGTGCAGACGACTGCCGTGAGTCGAAAAGTGCTTGCGAGGCCTCCGTTCACATTTCTCCACAAACTGCTGCTAGAAACT
TTGAGCGAGTTCGACCTCTTCTCGGAGCAGCAAATGGACTTTTCTACCCTGACCACGAAGCAAGCCAAGGTACCTACCACCTGCCAACAGAGCAAATGTA
CTTGGTATCACTCACAATTCCACCCGATTTCCGTCACGTCGTAGGCTGCTTTCTTGACGCGTGCGATCGCGTTCGTGACGTTCGTGCTGAGCGCGCATTC
TGATCGGCACCACATCTCCTGTCTTTTGCTCGTGAGCCCTGTACAA