Description :
From Genome Similarity Track
Location :
Scaffold_613:3722- 6366
Sequence
2644 bases(100 bases per row)
TTACTGGCAAGACCAAGCCACTTACGCAAATCTTTTTTATTCTTAGGAGTCGGCCAGTCTACTATAGCCTTGACCTTAGCGGGATCCGCTTTAAGGCCGC
ACTTACCAATGAAACATCCTAGAAAAGGAATCTCCTCTGAACCAAAAGTGCATTTAGGCGCGTTGGTGTACAAATTAGTAGTGCACATGCACTCGAGCAC
GGCCCGCAAATGACCGATGTGGTTGTCAACATCTGATCGACCTTCTTTGGCACGACTATGGACAAAAGTGTCATCAGAGTACGTCTGTGCGTAATCCCGA
TGTGGGCGGAAAAGTTGCATCACCAGAGGATTAAATGTTGCCGGATAATTAGACATCCCTTGGGGTATCACCATCCATTCTCACAGCATACCACTCGGGG
TGCTCACTGCTGTAAGCGGAATATCACTCGCTTGCATGAGCAATTGATAATATCCATCGACCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTT
GTTTTGAAGAACATCCTTTCGAGGAATGGGTGTCTGTGCCGATATCTTAGCCGCATTAAGATTGTTATAAGCATGCAATTACGCCACTTGGCGTTCGGCT
TTTTGACACAAAATGTCGGTGTCGAATGTGGAGATTTACTCTCACGTACCATTCCTGCCTCGTGCTTAGCACGGAAGAAGTCATCAATGACATCATATTT
CTCCTTAGGCAAGGGCCACTGTCGTATGACACAGTATTTCGTCCCAGGAACTAATTCAATTTCATGACGGACACCTCTATTTGGAGGTTGAACAGAGGGT
GAATCGTGGCACACCACATCTTGAAATTCCTTGACTATGGAATAAAAGGGATCATGAGGGTCTTTCAATACTGATGACCCACTACACGCACTGAGTGCTG
CTTTTATGTCCTACAGAACGGCTTCATCATAAAGTGATGTAGAGTTCAACTATATGATGTCGGGTCGAATGCCCACCACCTCTGAAAGGTCACTATTCTT
TAGTGAGTGATCAAACCCATTGAACGACAACTCTTCAAGTTCTAAAAGCGAACTTAATGAGCGTTTAGCCTCAAGGCTAATTGAACCATCGCAAGCACCA
GTCGCTCCGTTGACGAGTGTATACAGCTGACAGTCATCATCACTTTGTGACACATCAAACGATGCGTTATTCGTATCTCTCTGATCGATATTATCATCGA
ACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN