Description :
From Genome Similarity Track
Location :
Scaffold_70:37211- 38901
Sequence
1690 bases(100 bases per row)
AAACCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTC
GTGATGCTTGACTGCAGCAGCTGCGCAAAGGCGACATCCTTCTCTTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGACTGGGACCG
CGCGTCCGAACAGAGATTTCGACTTGTGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTT
CAGCAGCAGAGGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCCTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTG
CCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTG
AATGTGAAACACTCGTCTTCAATCTTTCGAAGGAACGGCGTGCCACAGAAAGGCCACCTTCAACGACAAAATGCGCATCCTTGAGCTGGTACAGCGCCGC
ACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACAGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTG
ATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGC
TAATGCTGATCCGACACTGTGCAAACCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAA
CGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGCTGTAGTACAGGGTCG
GTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATC
TTCTCCGAGTATTCAAACCACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCGAA
GGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCAAGAAGCCGCTTGCTGCA
TCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAGCAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCT
TGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTAAAAAGACGATCAGTCCTGCACG
CAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCG
CATACCGCACCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCT