Description :
From Genome Similarity Track
Location :
Scaffold_53:37204- 38319
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16010hypothetical protein

Sequence
1115 bases(100 bases per row)
TCAATGAGATGGGCGTGTCTGCGTTCGTGTATTGGCAACCGTTTGACGGCGGTGGCTGGGGCCTCATCAACTCGGCTCCGGGCAACATGACCATTGACAC
GGCCAACCCGAAGTACTACGCTTTGGCACAGTACTCACGCCACATTCGACCCGGTATGACCATCTTGTCAACGGATGATCTAAATACCGTCATGGCTTAT
GACACAAAGTCCAAACTGCTCGTGCTCACTACGGTGAATGCGGGTGATGCAGTTTCGAAGGTCACATACGATTTGGCGAGCTTCAAGGCCGTTGCTGGAC
CTGCTTCGGCTTGGACGACGGAGACGAGCGGCAAGGGAGCGCTGTATAAGTCGTCAACAGTGAAGCTGTCTAGTTCGACGTTCAGCGCATCGATTCCAGC
TGCGTCGGTGATGACATTCGAGATTGAAGGGGTTGCTATGTAAGAAGCTTTAGTACATTGTACGGATTGCGAGTTGCTTGCCAGGTGCGCTAGCTAAAGC
TGGGTTCCAAGTTCACCTTGGTAATCGCTTGTTTCAATTGCTTATTGTTCTGTTCAACGATTTCCCAACTTGTTTTGGCGTAACCACGGTCACACACAAT
GCGACACTATCATGGTTCCATCCTCCAAGTTGTCCTTGTCACGTTCGTCCCCACTGGGGATGAAGGTGATATCGACGTCGCGTTGAGCGGTATGACGGAC
CATTGCGCACTGTTTCACACCAGCGACCCAGTTCCAGCTCGTACTCGTCGGATCCTTGCTTGTTCATCCAGTCCAACCACAACGACTCCATGATTTAAAA
TGCCGGTATTTTATCTTGCCCCCTCGGCATCAATGGCCACGTTTGATCTGTCGAGTTTGGTCGGTACTTCGAAGGTCAGTTTATCAGGAACACTTATTAG
CGCGTTGATCCCAACGCATCGGTAATGACCTTTGAAGTGCAGGAAGCTGCTCCTTTCGTCCTTGGCAGCCACACAGCAAATGTGACGCATAACAAAGTAA
CGAAGCATCCATAATTCCGAACACGCATATCCTTGTACGCGGTGAAAATTCGCTACCTTGAGGCTCACCAACACCACGAATAAGAGCTGTGTACGGGTAC
ATTTCACGCAGGTAT