Description :
From Genome Similarity Track
Location :
contig_31:372022- 373397
Transcript NameFunction/comments
g7532.t1hypothetical protein

Sequence
1375 bases(100 bases per row)
AGTTTTGCTTGATTGCATCTGCGCGAGCATAATGCAGATTGTGGCTCGGCAACAGATGCGCACCTGTATCATACTAAACTACCAATGACTCTTGGAGTAT
TCAATGACAAACAGTATATTGAAGCATCGCTTCTTGATTCTAAGGGTTAAACGAGAACAACTTGGTGGGGTACGCCTTGTCGTATGCGTTGTAGTACGCA
CGCCAAATATTCGTGTTCGGGCTGCTGGCCATGGTCGCTGGATCCAGCTTCAACACATTCTTGAAGAGATAGTCCGGAGTTATCCCTTCCACCATCCACT
TGTTGAACAATGCAGACTTCGCTTTCTCCAAGTTGGTGGCTAGTTGCTCTGTGGCCGGGACCTTCTTCGCCGCATTGAGCATTTTGGTCAGTGTTTCGTC
ATTGTAGCTCTTCATGAACGTCTCGATCATCGTTGTCTTCTTCGTAGGGAGCTTCTCGTTGAATTGGTTCATGTACTTGACCCAGGTGCTCAAGATAGGG
CTGCTGAGGAGATCATCTCCTGCCTTGTCCAAGTTCGCCGCCTTGAAAACACTGTATGGGGACTTGGTGAATTCCAGCCAGCCCGCCAGCATCTCATCCA
TCATTTTCGTCGCTCCTTCACTCTTGGCATTTTGTGCCGAAACCAGCAACTTCATCAGACCTTCGTCTCCATAGCTTTTCTTGAAGACTTCGAGCAGAGT
TGTCGGCTGGTTGCGCTTTTTCTTGTTGAAAGCCTCAAGGTACTTGGTATACATAGCAAGTTGCGGGCTTTCGAAAATATCGCTCGCCGCCTTATTGAGC
TTCAGCGTCTTGAAAATATCATCTGGGGTGCTGACCAAGCTCACCCACCACTTGACTTGCGCACTCTCCAACCTCGTAGCAATGTCCTTGGTGTTCGGGT
TCTTTGCCGCTGCTGCCAGCATCTTTGCCATGTTGTCTGACTTGAGGTGAAACGCCAACGCCGTAGACATCTCTTCGTCTGCATTACTTTTATCCAGCTT
TGTCACGTACGTAGACCACGCTTTCCACTCTGCGCTTTCGAATAGGTTGCCTGTCACCTTGTTGACGTTCAGAGTTCCATAGGCCTCTCTGGCGTTTGTC
TGTGCGCTCAGCATGGACCGGATCTTGCTGTTCCGCGAAATATCATCCCAAGCCGTGCCAACGTTGCGCGCGATATCGTCGAGGACGGTAATACCGAAGC
CCCTCTCTTCGCCTTCAGCGTTTTCGTTCACGTTTGCTGCTTTATGTCTCCTCAGAAACCGCTTGATTGGGATGTCCTTCGGGCCAGTTGAGGGCGAACG
AGCCAAAACAGTCGTGACATCTCTTGTCGCCGTAGCAGCATTGACACTTGCGAGGAAGGCAGCCACCAACAGCAC