Description :
From Genome Similarity Track
Location :
contig_31:372019- 373394
Transcript NameFunction/comments
g7189.t1hypothetical protein

Sequence
1375 bases(100 bases per row)
TCAAAGCTTATTCATTTGATCAAGTTTTGCTTGATTGCATCTGCGCGAGCATAATGCAGATTGTGGCTCGGCAACAGATGCGCACCTGTATCATACTAAA
CTACCAATGACTCTTGGAGTATTCAATGACAAACAGTATATTGAAGCATCGCTTCTTGATTCTAAGGGTTAAACGAGAACAACTTGGTGGGGTACGCCTT
GTCGTATGCGTTGTAGTACGCACGCCAAATATTCGTGTTCGGGCTGCTGGCCATGGTCGCTGGATCCAGCTTCAACACATTCTTGAAGAGATAGTCCGGA
GTTATCCCTTCCACCATCCACTTGTTGAACAATGCAGACTTCGCTTTCTCCAAGTTGGTGGCTAGTTGCTCTGTGGCCGGGACCTTCTTCGCCGCATTGA
GCATTTTGGTCAGTGTTTCGTCATTGTAGCTCTTCATGAACGTCTCGATCATCGTTGTCTTCTTCGTAGGGAGCTTCTCGTTGAATTGGTTCATGTACTT
GACCCAGGTGCTCAAGATAGGGCTGCTGAGGAGATCATCTCCTGCCTTGTCCAAGTTCGCCGCCTTGAAAACACTGTATGGGGACTTGGTGAATTCCAGC
CAGCCCGCCAGCATCTCATCCATCATTTTCGTCGCTCCTTCACTCTTGGCATTTTGTGCCGAAACCAGCAACTTCATCAGACCTTCGTCTCCATAGCTTT
TCTTGAAGACTTCGAGCAGAGTTGTCGGCTGGTTGCGCTTTTTCTTGTTGAAAGCCTCAAGGTACTTGGTATACATAGCAAGTTGCGGGCTTTCGAAAAT
ATCGCTCGCCGCCTTATTGAGCTTCAGCGTCTTGAAAATATCATCTGGGGTGCTGACCAAGCTCACCCACCACTTGACTTGCGCACTCTCCAACCTCGTA
GCAATGTCCTTGGTGTTCGGGTTCTTTGCCGCTGCTGCCAGCATCTTTGCCATGTTGTCTGACTTGAGGTGAAACGCCAACGCCGTAGACATCTCTTCGT
CTGCATTACTTTTATCCAGCTTTGTCACGTACGTAGACCACGCTTTCCACTCTGCGCTTTCGAATAGGTTGCCTGTCACCTTGTTGACGTTCAGAGTTCC
ATAGGCCTCTCTGGCGTTTGTCTGTGCGCTCAGCATGGACCGGATCTTGCTGTTCCGCGAAATATCATCCCAAGCCGTGCCAACGTTGCGCGCGATATCG
TCGAGGACGGTAATACCGAAGCCCCTCTCTTCGCCTTCAGCGTTTTCGTTCACGTTTGCTGCTTTATGTCTCCTCAGAAACCGCTTGATTGGGATGTCCT
TCGGGCCAGTTGAGGGCGAACGAGCCAAAACAGTCGTGACATCTCTTGTCGCCGTAGCAGCATTGACACTTGCGA