Description :
From Genome Similarity Track
Location :
scaffold_250:37194- 38832
Transcript NameFunction/comments
g6316.t1 conserved hypothetical protein
g6317.t1 Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
1638 bases(100 bases per row)
TGCTCTCGAACGACGCGGATGTGGGGAAGGAGTCCACACGCCGCTTACTGGAGCCGTATGAGCGACACCGTGCTCACGATCTGCGCGCCGAGTGCTACCG
ACGCGGCATCCGCCCGACTAAGAAAGGTCCAGGGGCGAATGACAATAAAGGGGGCTACATCGAATTATTGCGCAAATTTGACGGCACCATAACTGAAGGA
CCCCCGAATAGTAATAATGTCCATCGAATGTCCAAGCGAGGTGATATCGAGACTGAGGACGACGAAAGCGTCAGCAACGGAGAGAACGAAGTCCAGATTA
TCAACAGTATGACTAATAAGAGGAAACTCCCCACCATGGCCATGCAGACTCAGACGGACACTGGGAACAACACTGCGGGTACTGAATTACAGGGATTCTA
CGACGGGAGTCAGCCCAGTCTGGTCTCGGTGCTGCCTATGCAGTATCCGTCCCCAAATGTGGGGAAACCTTCGGCTTCAACCAGCAATAATCCGACCACA
GACTTGGAGATTTTGAGCGGGATCGCCAATTCTTACACCCAGAGCACGGCAGCTGATGGACAATTGTGCGGCAATTGCAGAACGGTCGTCACAGATCAGT
TGATGGAGTCCATTCGACTGGGCAAGACCAAGATGAAGCTGCAGGAGTGGCAAAGGATGGACGAGCAACGCGATCGAGACACCCGCCACTTGAAAGAAGT
GCTGGACATTCTGCAGGATTTACGGAAAACGTTCCACGAGGTTCAGATGCACAGCATGAACCATGAATTGATGGTGGAGCTGCGGGATGATATCGCGTTT
TTCCAGAACCTGAAGGAACAAGCCAAGGAACGCATGCGACAGGCGATGCAGGAGACTCGAGATCGCTCCAACAAGCCTAACGCTACAGCGTAAGCTGCGT
TCTCAACGCTTTTATTCTTCTTGGATATACGCATTGCAGTGTGGAGATTCGAAGCCTGTGGTGGTGTAGGAGCACGCAAGAGTGACAACCGTAGTTCGTG
GTTGGACTAAGCAGGGCAAAGATGAATGAACTGCGCTGAGAACGAGGAGGAGAATCTGATAACGGGACGAACTGGGGCCTTGAACTTGAACATGTCAGCC
ACGTTGCCAGTCCTCATTTGCGAATTTGCGGCCCAAGCTCTCATGACAGCGCACATTGAAGTGACTACCCCAACGTACAACCCGTCCGAGTCACCTCCGC
GCCGATGCTCCGCTGCTTTGGGACTGCCTGAACATCCTCCAAGACTGTCGACGTTTTCTCACCTCGACCTCAATGACTCCGGTGAAGGGGAGCATGCTGT
TGGCTGCTCTGTGGGTATGCTCGTGCTGCTTTCTCTACCTCGGATGGCCACTAACATGGCTTGGTCCGCACAATGGGCTGCGCTTGGTCCGTACCTCGGC
ACGATGCTGCCGCCGTTCGCAGTGCAGCTCACTCAGCTGATCGGTCCACTCTCCGGTATTCTCGTGGCACCGACAATTGGCGTCCTGAGCGATCGCAGTC
AGAGCAAGTGGGGGCGTCGCCGGCCGTTCTTGGTGTATGGAGCTGTAACAAGTGCGACGTGCTGGATACTGATGGGATTCACGCGGGAGTTGGGGGAGCT
CCTTGGCGACTCGGGTGATAACCGTTCTTGGACGGCTT