Description :
From Genome Similarity Track
Location :
Scaffold_1581:3719- 8570
Transcript NameFunction/comments
Phyta_totarag13294hypothetical protein
Phyta_totarag13295hypothetical protein

Sequence
4851 bases(100 bases per row)
TCGTGCGACTGCATGACTTGTAACCGGTTCTGCCCAGTACGCTGTCGTAAGAAATCATACAGCAGTCCTCCGTAATTGAGATCCAACTCATCGACCCATG
TCGTCTCATGAGTTCCTTTCCATTTGACTTCAAATTCACGTCGCGTCCGACCGTATCGGGTGGCCTGTCCATCTCGCACGTCCAGTATCCGTTCGACCTC
GAACACGTCCTCTCCTAACTCCCCCGCTTCCCAGCTATCCTCCGGGAGGATCTCTTCGTAAAAATCGAATTGTGCGTCAGCAGCCACCGTCAGTCGCGCT
TCAGGACGCGTCGGGAACTTCCGGACGGCCTTCAGCTTGGAGATATGTACAATcgggtacaactggtacgACGTGCTGTTCATCTCGAGACGCGCGGCAT
ACGTGTTCACCATCTCAGCGACTCGGAACGGGCCGTGCCACAGGTGTGCCAGCTTGCGAGCATACCCCGGTTTCATGCGATCCAGGTAGAGCCACACTCG
TGAGCCGGCTTCGATCGGGTGTTCCGTTGCGATCTCGTTCTGGAGTCGGGCCCTCGCGTCGACTGTGTCTTGGACTAAATCTAACGTTTGTGCTCGCGCA
ATCTTGTAGTGCCGTTGGATGCGTAATCTCCAACGCTTGGCCTCCACGTCGCGATGTGACGTATTACCGATAGCCAGTGACGCTTCCAGCGTAGTGCGCG
GATCCCAACCGTGCACGAGATAAAACGGGGCCTCGTTTCTCGTACGATCGTGTGCCGTGTTGAGCGCGAAGGTAAGTCTCTCCGCATACTCATCCCAGTC
TCGCTGATTGATGTCCGCGATGTACATCTTAATGGCCCTCGTGATCGTTTGCACCATACGTTCTGCAGCGCCGTTGGCTTGGGGCCTATATGCGAGCGTG
GCTCGCTGCCTCTGGTCCATGAGTTTGCTGAACGCCTTGAAGAAATCGGACATGAAGCCCGGCTCACGGTCGTGTCGAATCGCTTAGCTCGCGCCGAATC
GTCTGAAGACGGCCTCTTCGTATGCTTCCGCAACTGCCTGCGCGGTCCGTGACGTATTCGCCTTCACGATAACGAAGCCTGTAAACAGGTCGACccacac
gagcagctcggtgTTGCCCTTGTATGACGCTGGCAAAGACGGGATGTGGTCCATGGCCACGACTTGGAACGGATACGTCGCCACGATGTTGCCCGGCGAG
TCGCCTTGAATTGTCGGTCTCCCCTTTCCGGTTTCGCAGTCCGTGCATTCGCCCGCGAAACGTTGTACGCTCCTGAAAATCCCGGGCCAATGGAAATGGC
GTCGCAGTCGTTGATACGTCCGGCCAATTCCTTGATGGCCACCTTCCAGGCTCGCGTAATAGTGGAGCAGGACGTCCTCACGGAGCGTCTCTGGGACGCT
CCGTGAAGCACCAACTTCATGATCGTGTCGCGTTCTTCAGCCGACTCGTCTCCCCACACGTGGTAATACAGTAggtcaccttcaccttcttcataTTGGT
GGGCaatcttgctgcagttcttcgcCTCCCGTCTGGAGGGCTCTCCAATATCGCCGTTCAAATACTTCTTGAGATTCGCGATCCACAGCTCCTCATCTTG
GGCAATCCGGATGCGATCTAGCCTGAGTCGCTGTACGACCAGCTCTTGAAGGACTTCCGGTATCCTAACCGGGGTCGACGGGGTCCGCGCTGCAACAGAC
CGGGTGGTTACTGCTTGCACTTGTGCCGCCCCGTGTTTCGCGTCGGTACGATCTACCGTCGACTGGCTTAAATAGGGCGTTTCTGGATTGGGTCTTCTAG
ATCGGACGATCTCTCCGAGGCGATTCAACGTCTTCAGATCTTGGATTTCCTCCGGGCTGCGGACCTCTATGCCGCCTTGACGTTGCAACGCCTTTCCAGC
CAGCATATCGGCACTCGCGTTCTAATCTCGACGTACATGGAAGAAGTCGTAACGGGGCCATTCTCGTAGCGCGTTCCGGACTCGCTGCCGGAGCAGCTTC
AGGCCTGGTGACTTGCAGCCCATCTCTTCTCGCATCTGTCGGGTGGCGAGATTTGAGTCTCCGCAGATGATCAGCCTCGAGACGTTCAACCCTTCGAGGA
GCGAACATCCGAGCAGCATACCTTGGTATTCCGCCTCGTTGACCGTACGATCCACCGCGTATCCTGACGCAGCACGGACGATCTCCTATCCTGGTAGCTT
CCAGATGATCGCGCTAAACGCTCCACATTCTCGCTTGGCTTTGGCAGATCCATTGAAACTCATCACgtggagctcttcctccgGTGTGATCGTCGGGATT
GGGATGACGGCAATTCGCGACGGACGCTTGCGCGGTGCGATCTCTTCCAGGACGGTATCCACGAAAGCTCTGGGTGTGATGCTCGCGGCTAACGCCCCCA
GTatctcttcttctccctTCGTGGACCGATGAATCTCCAGCATCCATGGTGAGAGAATGGCGGCCCATTGCGACAGTCGACCTTGTAATCCTTTGGATCG
GAACAATCACGCCAATGTCGTGGGACGAGTCAAGACGCGTATCGATTTATCAGCCAGCATCGTGAAGCAGTTGTTGAGGATGCgcagcaaggccaagatc
tCTTTCTCGACGATATCATAGTTCAACTCGTTAGGCTTCAATGTGCGACTGGTGAATTTCACGGGCATGTACACGCCGTCGTGAGCTTGGGTGAGGACTG
CCGAGATTGCCCAGTCGCTGGCGTACACGATTACGACGGGTTCTCTGGATAAGTCGTAGTGCTTCAACGTCGGGTTCTCGgcgatcttgatcttgaggAC
CTCGAATGCACAGGACGCATGTCTCCACTTCTCCTGCTCGCAGACTTCCGGTTTCGCGACGTAGTCGTCAAAGTCGGTCTCCGTGAACGAGTACTACGTG
GTCGCGTAGATCGCGAAGTCGGCGATGAATCGGTGGTAGTAGTTGAGACTGCCCAAGAAAGATTGCAAGCCTTTGAGTGTACGCGGGAATTCTAAGCTCG
TGAGCGACTCCAGATTCTTCGGCTTCGCTTCCAACCCGTGCTCCGACACCTTGTGACCCAGGTAGTTAACCTGCGACATTCCCCACGTGCTCTTCTCCAC
ACTGATGGACAAGTGCCATTGTTCGCAGACGTCCAACAGGCGTTCCACCTTCTCGCACAAGTCGTCCCATGACGTGCCACCGATCAAGATATCATCGATG
TACGATCGACGACCTAGAACGGAGTGGATCCCCGGAAGTTCCGGCTTTCCTCCGTCGAAGACATCCCGTTTATCCCGATCTGGGGTCAAACGCCAAAAAA
CATAGAGCGCATTGATGATCAGTCGCTGGTATATCTGCGGCGCGTTACACAGTCCGAACGGCATCCGTAGCCATTCGAACAGTCCAAACGGGGTGATGAA
CGCCGAGATCAGTCGGGCCCGATCTGTCATGGGGACTACCCAGAATCCGCTGGCCATGTCGAGGGAACAGTACCACAGGTACTTGTCCAAGTCTTCCAGC
AAGTCGTTGACGAGCGGCATCGGATACACCATCAGCTGCGTCAGCCCGTTCACCAGTCGGTAATCAATGCAGAGTCGGATATCGACcccgttcttcttca
caatCACGACGTTGGGTGATGCCCACGGAGAAGTCGACAAACGGATCATGCCTGCGCTGAGGAGCCCCTTGAGCAGGTCGGAGACCTTCTCTTTGAACTG
AGGTGGGAGCTTACAGACGCGTTGCGCGATCAGCTTAgcgtcgccgacgtcgaTGTCGCAGACGACCCCTATGGCCGCAGACGGTAATGCGTTGCCCTTC
CCGATCAGCCATTTTCGCCGCTTCCAGATGATCTGGCGCAGCCGGTCTTCTTCCTTCGCAGCTACCTCCGGTGTGACCCCGGCTGGTCTTCCGACTTTGA
GATCTTCGATCTTCACTTCTGCAGTCAGAGAGAGTTCTGGCAGAACGGCCATTTCTCCCTCCAATTCTTCTGCGAATAGGTCCGACCCTTTGTGGAAGAG
TACAGCGtcgtcagcttcaacgaTCTCGTTTGGCCCATCCTCCGCGGTATCCACTGGCACCTGATTCGGAGAATGTGTTTCTTCTACTTTCTCCAGTTGT
CCCACGGTGTCGCACTTCTGCGGCTCTCGCGCCTACTCTTCTCATTCGGACGTACGCGTCGGTTCTGCTGTCGTCATTCGCGCAGCCGCCGCAATCGCAG
CGACCGTTGGGGGCGACTTCCGCTGGCGTTCCACTGGGTCTTCCATCTTCCTTTCGCCTCGACGCATGATTCCTCTGGGGATTTCGTATGTCGGGCTCTC
GGTCATCGGTCCGTCGGGTGTCCAGTCTTCGGCCGCATCGCAGGTGGAACGGTACGCGAGGTTCTGCCACCCTTGATAGCGTCGCGACTCAACTTGTACG
AAGCCGAAGGCGCGCGGAATAGCGTCGACGGGCGTCCACCAACCCAGCGTCGTGTGGGCGTCGAGCGTTATTGGCTCGTCACCGATACTGGTCACTCGCA
GGCACGTTCGTCGCCCAATCTTGCTCTTCACGAAGGTGCTCACCCATGCTTTTCCTCGTACAACCCATAGTCGTGGAGCGTTCCGGTCTGGTCGCAGGTG
AACGTCGTGCGTTCGCCCCgggtcgatcttctcgagcgACGTCAGGGCGATTGGGCGCATCTTCGCACCGTACAGCGGCCTTCTTCCGATCATCTGGATC
CGCACCTCGTCGGGCAGGCACGCCGTGCCGTTCGCGGTGTCGATGCGCACCCCGGCTGGCACCATGAAATTCATGCCCAAGATCGCGTGTTGGCCCGCTA
GGTCTCCGACCCAAAGGTCTAGGAAGTAGACCATGTTCCCCGCTAatgtga