Description :
From Genome Similarity Track
Location :
contig_20:37189- 39846
Transcript NameFunction/comments
g5189.t1hypothetical protein

Sequence
2657 bases(100 bases per row)
CGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAG
GCTTCATCCGCTTCGACCGTAGGGGGTGGCAGGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCAATCGCGATCAGCGCCTCGTCTACCTCCGCGCGAG
GTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACC
CAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACG
TCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACCATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACA
CGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGGTGCGATCTGGATCGAAATGTTTCAGTACCG
GGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATCTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTG
TTCGCCGGGGATGGACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAG
CGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTT
CCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCTACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGC
ATCGAGCAGTGCTTCAACCTTCTCACACAGCATGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTC
GGCTCTGGTTCTGGCTCGCCTGAATCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGTGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCA
ATCGCTGGTAGATCTGTGGCGCATTCTTCAACCCGAAAGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCTTTCGTGCGCG
TTCTGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAAATCGCTAATCAGCGGCATG
GGGTACACCATCAGTCTCGTCAAACTATTCACCATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATCA
ACGATCGGAGGCGTTTCGGCCTGGGTCATAGACTCCTTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCCTGCTCCATTGGCGGAGATTCTCTCGCGTTCT
GATCGCCGGTGCCACCTTCCTGATCCCTTGGAGACCCCTCAGTTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCGA
GGTTCCGCGGTCACGACACAGGATTTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTACCTCCACA
CGGTCGGTAGTAGACTGGAAAGCTAGATTCTGCCACTCGGCATACCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAA
GCCACATGCCGACATGGGTGTCGTCTTGCAATACTAACTTCTGATCGCTGATATTCGTGATCTTCAGATAGCGAGTTTTCCCCAACCCTGTCACCAGACT
CGGTACCCATCTATCTCCTCGAGTAACCCACAGTTTCCGGTGGCTCGACAAGATGAAACCCTTCCGAATTCGATCGACTCTCCGACTTCCAACTGGCAAT
GTTCTCCGAGCTTGACCTGCGTGACCTTCTCTCCGTAGAGTTGACGTCGGCCGGCTAGCTGAATCCGCACTTCGTCTGGAAGATTGATTGATCCATCAGC
CAGATCGAGGCGAATGCCAGCTGGCACCATGAAGTCCATCCCCAGGATCAGGTCTTGGCCGCCTGTGGGCGGACCAACCCACGCGTCGAAGTAGTACACC
AGTGATCCAGCGAGTGTGATCTTGATTCTGGTACGCCCATCCGCCATATAGGGATTCTTACCAACTCCTTCACATTCCAACTCTTGACTGTTGTCTATGT
AGCACCCAACCTTACGAGCAAAGGCGGCATCCAGAATGGACACCTCGGCGCCGCTGTCAAACAGCAATGTGGCTCTTCGTTGTTGATCTTCCCATGGCTT
TCGCCTGCCGGAATTTCTTGTCTGGCACATGGTACTTCAATATCCTCGCGACTCTCCGTGCAGGAGATCCAGAGCCATCGTCACTTCTGATCGCGAATAC
TCGTCGACTTGGTGGAGGCTGGAGATCGCCATGGTACGTTTGTCATGAAGGTCACAT