Description :
From Genome Similarity Track
Location :
contig_49:371610- 376634
Transcript NameFunction/comments
g8317.t1hypothetical protein

Sequence
5024 bases(100 bases per row)
CGCCGCGGCTGCATCTCGGACGATGCGGTAGCGCGCTGATCGCTTTTGCAGCAGGAGAACTTGGGGAGCTCCTCTGTGCACGTGGGCCACACCTCCTGCA
ACGTCGGCACCACTTGCGTGTCGTCCTTGAACTTCTTCGGCGAGACTGCCACACAGCGGATGAGGTTGTTGGCACAGCGCTCAAACGCCTGGAAGAACGG
CGTCGTGGCAGCGAACCGCCCAGCCTTCTTCGCGCCAAACCTCCAGACGTCCTGGTCCAGCGCGTGCGGGTCAAAGGCGTCTTCGACTACGCTCTCGTGC
GTGTACCCGACCATACGCTCCACCAGCGCCAGGTATCGAGCCTCATTGAATCTGATGAACTTGTGTACACGCGTAGCCAGCAGCTCCTTCAGCACTGCCA
GCAGGGCCTCGCCGTCGTACTTCTCTTGCGAACGACGAAGCAGGAAGAACAGCAGCTTCCCCACAGCGTCTTCCGGGTTGACCGGCATCTTCGGCAGGGG
CTTGACACTGGTCATGACGAGACGGATCGAGTGCACGAGCTTGGCCACGAGTTCCCACTGGAAATCGCTCAAGGGTTCGTCTCGCTGCTCGAGCAGGGCC
ATCAGCGAAGCCGACACGGTGCCACGAAACATGTTGGGGCAGAAGAGACCTGCAGGAGCACCCGACAGCAGCCCCGTCAGGATGTCAAGCACCTGCGTGC
CTGACGCTGCGCGCACTAGAGCGCTACCCAGCGCATCGTCCGGGTCAGCGACCATTTGTGCGTAGTTGTAGTCCCGGGCTCGAATGCTCAGGCCTCCGGT
GGCTTCCTCGCTGCCGATGAGTGTCAGGAAGTCGCGCGCTGTGACTACGTCCGGGGAGACCTTGGTGATGACGGCCGACCACGCGTCCATGAAGTCCGGC
TTGCCGTTCTTCTCCGGGAGCTGCAGCACGGCGAGGTGGGCCAGGAACAAGCTTGCCACTGTCTGCAGAACCGTCTTCGAGGTCGAAGACGTCGTCTTCC
TCCAGCGCATCTTCTGTCGCCTCTTGTGTCGTGAGCAGTGTGATAGCACTGATGGACGCCTCTAGCTCGCTGGACGTGGTGATCTTTGCTGCAGCACACC
AGGCAGCGACTCGGCGGTGAGCTTCAGGTGGTTCTGGTTCTCGTCAGGCAGCAAGTCGCGAATCTTCTCGACGAGAGATGTGGCGCGATCCAGGGCGTCG
TTGTAGCCGAGCTTGCCCGTGAGGCACTGTGCGATGGTGATCAACAACTCAACCTGCTCGCGCAAGCCTGACGCTGCGATTGCACGCTTGGCGAACCGAT
CACCAACCACGACTGTAGCTCGGTCAAGGAAGGCGAAGAGCACGTCGCGCGTGTCTCCTGCCACCGGGATCGCGTTGTTCTTGACGTCTGCCTCGCAAGA
CGGAACGCTGAAGCCTTCCAGGTCGTAGAAGATGAACGTGTCCAAGCTCGTCTCGCTGGGAGCCTCTTCCTCAGCGGCAACCTCGAAAGTCCCCCCTGCG
CAGCGATCGAACATCTTGGAGAGGATGACCATAAGCCCTGCCGCTAGCTGCGTGGCGGCGCGCACCTTGGGCTCAATGAGCACTCCGTCGAACGTTTTGG
CGATGCTCCCGTACATCCTGTGGTCGCTGTTCTTGACGTACTTGACGACGTTTACGATGAGGTTCCCCTCAAAGTGCGCCTGCACCAAGGCGAGCACGTT
GAACATGTCCGAGTCCACGATCGAGTGCTTCTCCTTGAGGAAGTTAATCTCGTGCTCCGCTTCGCACGTTCTGGTTTCCGCGAGGAGGTGCGGGCCTGCG
TCTGTGATCAGGAAGGCGATCGTGGGCATGGTGCTGTCCAGCGTCAGCAGCTCTGCGAAGCTGCCTTCTGGTTCTCATCGCCGTCTCCGCCGTTGGCACT
CACACTCGGGTGGCCAGGAGGGACGCACAGCTTCACGGAGGTGATGAAGTCCATCGCCTCTTCCCCTTCCGTAAAGCTGTGGTTCGTCACGAAGCAGCCT
TGCGAGCTCTCCGTAAACGTGATGATGGTGATCATGACAGCGTACTCCTCTTCAAACACCGAAGCAACGAGGTGGCGCACAGTCTCCTTCACGCCTTCCA
GCTCGCTGCCCATGGAGCCAGTGATGTCGAGCAGGAACACGAGGTTGATCATGATCTCCGCGAAGTGGTGGGCCTTGAGGTGAAGTGGCTGGTTGCTCGG
AAGCAAGTTGGAGAATGGTCAGTGTCGGCAAGTCGAAGGTGGGTGGAAATCATGTGAGACCAGATATAGTGAGTGAAGGTCAACTTCAACTTGTACCACA
ATATTTTCGTGAGTGAGGGTTAACTTCAACTTGTACCATAAATGTGGACCATACGTGAGGCGTTTGTGGTGCGCAGGTAGCTGGATTGGAGGCTACGAGG
TTCGACCACAGATATACTGAGCATACTTTGCTATATTTGTGAAGCACCAAGGCAACTGGTTTTGTATGTCAGCATTCTCCATCATTCAGACAACCAAAGC
TATGCCGGTTTAATGACTTGAGTAAACAGTGACTGTGAAAATGTCAAGTGTCTGGGATACTTGGTCCTCGTTTGAGGGGCGAAGTCACTCGATGACTCAA
CTACAGCTAGCGATTTTCATCCTTCCTTATTCACCTCCCGCCCAAACTATCCTTGCCTGGCTGTCTGCCCCTCCTTGTTCTTGTTGGGCTTGTCTCCTTG
TCATCCTCTTCGGCAATCGGCTGGTTCGACGAAAGGTATACCTGTCGGATAATACGCGGGGCCGCAAACAAAAAATATCCGACAGCACGCGCTGCTCGAT
CACCCCAGCGGCACAAACCCTACGGACTTCTTCCACCTTCTCTTCTCTTGCTCTTGCATGAACATTCTGGGAGAGTGGAGCACACTCAGGAATGCAGCTT
TGCACTTCATGGAGTAAGGTTGGCATTGTCGATAAATGGGTTGGTTGTGAAATTTCCTACATTCTTTACAGAATTTGGAATACGGTGACTTCATCCCGAT
ATATTCCAGTCTCTGGTTCTCCTCCGGCATCTTCACAATTGCATCCACGTAGTACTCAAAGTTAGGAGCAGTGCCAGCTAAAAAGATGACTGCGGGAACC
ATGCCCTTAGCAAGCATACACGTAGGCGTCGACACATTTCGTGAGTGGGTTGTTTGGGTCGCACAAAGCCTTTGCGAGCTCCGCGGCATCGTACCATGGG
ATATCTAACTCTTCTGGGTATTCAGTTGTCAGCACGAATGTAACTGCGCGCATGTCTGAAGTGTTCAACCTGCCAAGGCTAGTAGTAGCAAACCTTCAAC
AGAAGAGCGCATACGTGCTCGTTTCAAAAAGAAATCGTAAGCCAGCCACATCCACCAGTGATCTCGGTTAGTAAGATCCCGAGCATAAATCCCCAATTCT
AGCGACAACTTGGTTACATCCTGCGTGTGTCCTACGGCGGAGCACATGGCCTCGAAATCGATGGCTGGCATCATCTCTTCGCATATCAATTCGAGCAATC
CTGGATCTTGGTCCGATCCTTTGACACCAAATGCGGAGTTAACATGTTGATTTCGACGCGTACTGTCAAAGAGCCATCTCAGGAGCTGCCCGAGGGATTT
TCTTGCTGTGAACTTGTTGTCGTGCCCTCACGCTGAATCGACATGACAAGTGTCAGGAGTGAAAACTGCATAACGTGGTTCTCAACTAGACTGTCCATCA
CTTCTGGAGTCCAACAGATACCCTGAAGATCTACCGATGTCGACTCAGTTACAAAAGTACATCTGATAGCTCCACTCTCCAAATCCTCTGGGTAGTACGT
ATTTCACTGCTCTTGAGCTTCCTTTTCAGCTCCGACAATATCCACTATTTCGCCAAGAGAGGTTGGAATCGACTCCGATTTAGTGTACAGGTCCAATTTC
ACAGGAATTTTGATTTCTACTCCAGGTTCCCCAGGATTCACGTTATCATCCAGTGCTGCAATCCAGTCCAGTGCCTTCAGATACTCCTTGCTCTGGTGTT
TTCGTTGATGCGTCCCGCAGAAACGCACGGAGTCGTAATCGATCTTACCGTTCTCGTGCACATGTCCTTCACGTCCACGTCTAGCGAAAACTTCACTACA
TTGTGGCTTCAAACAATTCATCTCCGTATTTCCCGAGCTTGACTCCACAATGCTGAGTTAGGAGATACCGCCACGCTCGATAGTCTGCGTGTTCTACTGC
TGCCATCAGCGCCAGAGCTTCTCGGATTTCATGAAACTCTTTTCATCTTTCCTCTTGAAAACTGAGCTCATCTTTCTCCTCTCGGCGTCTCGGCATGGTC
ACTTGTAGTACAATTGCATCCATCCCCACACACATACTCAGTGGATTTAGGGTCGGAATATCGGTGTGAGGCTTCAACACCTCACACCATGGAGCGAGCA
AGCCCCAACGCTCGTCCATTCTCGAGATCGACAGTCCAAACAGGAAATGGTCGGTAGTTTTGTGCCAACGCGTTGTTTCCTATCTCACATATAATTAGAC
TTCGTAACGAAGTTTGTGTCGGCTTCAACAGCAGCAATCGACGACAATGTCTTCGGTTCTAGTGGAGCGCACGTACCAGGCGCTCATGGGCGTCGTGCAG
ACGACTGCCGTGAGTCGAAAAGTGCTTGCGAGGCCTCCGTTCACATTTCTCCACAAACTGCTGCTGAAACTTTGAGCGAGTTCGACCTCTTCTCGGAGCA
GCAAATGGACTTTTCTACCCTGACCACGAAGCAAGCCAAGGTACCTACCACCTGCCAACAGAGCAAATGTACTTTGTATCACTCACAATTCCACCCGATT
TCCGTCACGTCGTAGGCTGCTTTCTTGACACGTGCGATCGCATTCGTGACGTTCGTGCTGAGCGCGCATTCTGATCGGCACCACATCTCCTGTCTTTTGC
TCGTGAGCCCTGTACAAGTTCTTGCAGGTGTCAGCGTCTCCGACACGCTCGAGTTTCTCCTCCAACTTTGCGAGGTTTGTCGGATCCCGAATCGCGATAT
CAAGGATGCTGCGGCACAACAAGT