Description :
From Genome Similarity Track
Location :
Scaffold_23:371609- 372944
Sequence
1335 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGAATTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGAT
CCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGCTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGCATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGG
AAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAGCTCTGTCGACGGAAGAGA
GGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAA
AGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAGGCTGGTCAGACAAGGATCT
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCG
GTAAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGCGTTCGACGCAG
AGGATATTTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGA
TCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACT
TTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCG