Description :
From Genome Similarity Track
Location :
contig_163:3716- 8812
Transcript NameFunction/comments
g11840.t1hypothetical protein
g11841.t1polyprotein
g11842.t1AlNc14C163G7818

Sequence
5096 bases(100 bases per row)
TGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAG
CCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGCCCAAGACCCCGACTACGCCTTCGCCATGGACGCCACCCCGACCACGACCGCCCGCATCAACAAG
TTCAACGGAACCAACTTCCACACGTGGAAGTTCAAGATGCAGATGGTGCTCGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTGGAGC
ACTGCACGACCACGGCGGATCAAGCGACGTTCAAGAGGAAGTCGCGTAAGGCGCTGGCGATCATCTGTCTCGCGATGGAGGACTCGCAGCTGCCGCTGGT
TCGCTCGGCCAAGGACGCGCATGATGCATGGTCAAGACTGGAAGGACACTTCGAGAAGAAGAGTTTGGCCAACAAGCTCTTTCTTCGTCGGCGTTTCTTC
ACGACGATGATGGACGAAGGTGATGATGTGCTGGAGCACATCAACAAGCTCAAGACGCTGGCGGAGCAGCTCGACGCGGTTGGCGCTCCGGTCAGCGAGG
ACGACTTGGTGATCACGCTTCTGGGCAGTCTGAGCGAGTCGTACCAGTTCCTGATCACGGCGTTGGAGTCGAGAGCCGACTCGCTGTCGTGGGAACTCGT
GACGTCTCGGCTGCTGCATGAGGACATGAAGCGCAAGGAACAAGGTGGCGGCGGCGTCGACGGAGCCGCGCACGGCCAAGGTCAAGCGTTCATGGTCAAC
AACAACAAGCGCAAGGGCCGACCGGTGAAGAAGACCGGCGCGTGCCACAACTGCGGCAAACAAGGACATTGGATCGCGGAGTGTCCCTCGCGGGTCCAGA
ACGACGCTGAGCGATATCGGTCGCAGCGTGCGAACGTCGCGCAGGACGAAGAAGATCCTGGCGACTACCTTTTCTCGGTTGGTCGTACGAGCAGTACCGC
CAAGCCGAGTGACATGTGGCTGGTCGACTCGGGTGCGACGCAGCACATGACGAGTTCCAAGACGTACATGAGGAACTACAAGACGATGGCTCCGGTGGAC
GTGCATCTCGCGGACGACGGTGTGGTTCAGGCGGTGGGGACCGGCGACATTGTCATGTCGATGAAGACGCCGCGCGGCATGAAGAAGGGTGTGCTCACGA
ATGTGTGGCATATCCCGAAGCTGTCGCGCAACCTGTTTTCGGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACGGGTGCTTCGC
GGACAACAAGGGTCTCAAGTGGCAGCTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGCCAATGCGGCA
AGTTCGAAGGATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAGAAGAGCT
ACGGTGTTGGCATCGACATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCC
GAACCGTGCGAAGCACGTGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATC
GACGACAAGTCGCACTTCTGCGTCGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAACTCAGACCG
GCAAGCGCGTGCAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCAGAAGTTCAC
TCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGCTTGCCCAAG
ACGTATTGGGGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCGCACCAAGTTGGACGGCAA
GAAGCCGCTGCTGGCGAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGT
CGGTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACG
TCTTCGACAGTGGGAGACGCGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGA
CAACGAAGAAGAGGAAGAAGAGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAAGTCACGGAG
GTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACTCTGGACGAGATGTCGGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACG
TCGTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTC
GCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGA
GAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGT
CCATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACAT
CTACATGGCACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATG
TGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCT
TCGTGGCGCTCTACGTTGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGA
CCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGACCCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGA
CCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGA
CACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGC
CAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGG
AAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGG
ATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGG
CTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGC
AGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACGGA
CATGCTGGCGGACATGATGACGAAGGCATCCTGCGTGCAGTTCAGTGTGCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGT
GTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGC
TGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCAC
GTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAG
TTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTGCCTTGTTGCCGTCGGCTACCGAAAGTTCGCCCTCGTT
TCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCACATGCCGAGCATATCCTTGCCCGTCGAAA
TGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCTGGCGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCG
TCCACGGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCACTTGTCGATGGTGTGCCCCAATTTCCCGCAGTAC
GTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCCGCGTCCTCCGTCTTCACCGTCGCCGTCTTCTCGCCTTGCCGCTTGATGTGCTCATTCG
TCAGCACCTTCACGACGTCTTGCGATCGCAGCTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGGAGACTGCGCAACA