Description :
From Genome Similarity Track
Location :
contig_31:371556- 372929
Transcript NameFunction/comments
g6112.t1hypothetical protein

Sequence
1373 bases(100 bases per row)
CTTAGTAATAATTCTTGAATGGAACAACCATTGTGGGCCCCACGGAAGCAATTTAAACGGGAATATTCAAAGCTTATTCATTTGATCAAGTTTTGCTTGA
TTGCATCTGCGCGAGCATAATGCAGATTGTGGCTCGGCAACAGATCGCACTCTGTATCATACTAAACTACCAATGACTCTTGGAGTATTCAATGACAAAC
AGTATATTGAAGCATCGCTTCTTGATTCTAAGGGTTAAACGAGAACAACTTGGTGGGGTACGCCTTGTCGTATGCGTTGTAGTACGCACGCCAAATATTC
GTGTTCGGGCTGCTGGCCATGGTCGCTGGATCCAGCTTCAACACATTCTTGAAGAGATAGTCCGGAGTTATCCCTTCCACCATCCACTTGTTGAACAATG
CAGACTTCGCTTTCTCCAAGTTGGTGGCTAGTTGCTCTGTGGCCGGGACCTTCTTCGCCGCATTGAGCATTTTGGTCAGTGTTTCGTCATTGTAGCTCTT
CATGAACGTCTCGATCATCGTTGTCTTCTTCGTAGGGAGCTTCTCGTTGAATTGGTTCATGTACTTGACCCAGGTGCTCAAGATAGGGCTGCTGAGGAGA
TCATCTCCTGCCTTGTCCAAGTTCGCCGCCTTGAAAACACTGTATGGGGACTTGGTGAATTCCAGCCAGCCCGCCAGCATCTCATCCATCATTTTCGTCG
CTCCTTCACTCTTGGCATTTTGTGCCGAAACCAGCAACTTCATCAGACCTTCGTCTCCATAGCTTTTCTTGAAGACTTCGAGCAGAGTTGTCGGCTGGTT
GCGCTTTTTCTTGTTGAAAGCCTCAAGGTACTTGGTATACATAGCAAGTTGCGGGCTTTCGAAAATATCGCTCGCCGCCTTATTGAGCTTCAGCGTCTTG
AAAATATCATCTGGGGTGCTGACCAAGCTCACCCACCACTTGACTTGCGCACTCTCCAACCTCGTAGCAATGTCCTTGGTGTTCGGGTTCTTTGCCGCTG
CTGCCAGCATCTTTGCCATGTTGTCTGACTTGAGGTGAAACGCCAACGCCGTAGACATCTCTTCGTCTGCATTACTTTTATCCAGCTTTGTCACGTACGT
AGACCACGCTTTCCACTCTGCGCTTTCGAATAGGTTGCCTGTCACCTTGTTGACGTTCAGAGTTCCATAGGCCTCTCTGGCGTTTGTCTGTGCGCTCAGC
ATGGACCGGATCTTGCTGTTCCGCGAAATATCATCCCAAGCCGTGCCAACGTTGCGCGCGATATCGTCGAGGACGGTAATACCGAAGCCCCTCTCTTCGC
CTTCAGCGTTTTCGTTCACGTTTGCTGCTTTATGTCTCCTCAGAAACCGCTTGATTGGGATGTCCTTCGGGCC