Description :
From Genome Similarity Track
Location :
Scaffold_11:371503- 379588
Transcript NameFunction/comments
Physo_529148Hypothetical protein
Physo_252745Hypothetical protein
Physo_528333Hypothetical protein
Physo_341467nuclear hormone receptor

Sequence
8085 bases(100 bases per row)
ATGATGCGGGGGTGGTCTGGAATCCTCCATTCAACAACGATAATTTTGCTCTAGCAGCTGTGTTGAAGTTTGAGGTATATATATGTACGGTAGGTATATT
TGCATCGAGTTGGGATCATTTTTTTTTCATTGTGCCATCAAGTTACTTCGTTTTTCCTCTGCGTCTAAGAATTCCCAGTATTTTCTGAAATATATTTCGG
ATTTATCCATGAAATTTATCTTGTTTCGTATAGACGAACATTCAAATACATACAAAGAGTAGCTAAACGGCAAAGTAACCCAGGGTCAAATGGGTATTTC
ATGCTGTAGACTATCAACGTTATGCCTGGCGCGACAACGTACTGCATTGCTACGTAGTACACGCTAATAAATAACGAATGCAGATTTAAATGTACGTGTA
AGCCTAGACATATCTTGGCGTCAAGATTTTTTTCATTCAGATTAAAAGAAGAAGAAGAAAAAACTATAGCTTCCCAGCTTACTGTTTTTTGCTAATTTGC
AGCTGCCCCTCCAGCCTTGTCGCGAGGTCCTTCGTTTCGTCGACCTCTTTCGCTGCTTTGAGCAGTTTTGCAAGCTCTTTCTTCGAGCAGTTGGGTTGCA
GCCACCGAGAACATGACCTCGTCCGCAGTCTTGGGATCCAGCTTCGTCACGTAAGCTGCCCACCAAGTTGGCTCCGGTGACTCAAACAGCAACGAATGTA
GCCGGTTCAGCCTTAGTCGATTGAAAGCTTCCATCGCTGCGATCGGTTTGCTGAGCCACATCTGCTCACGCAATCGCCGTCCGAGTTCCTTCGTGCGACT
GCTAGCTTCTGCCTTATAAACCATGGAGCTGAGTTCTCTTTCTGTTGTGGTTTAGAATAAGTACCAGCTTTTGACATACCGATCGGAGTTTCTAATTTCG
GATAGAAACAGATGCATGAAGTACAAGAACTTGATTTTCGTAAAGTATAATAAGGATAAGTGAGTTTACTGAGCTCCCCCAGTTTACTAGGGCTGTAGGA
AAAGAGAACCCGACCGGATGAAGAAATGGAGTCGGCCCCACTTTCAAATTGGCCCTCCGTCTGACGGTCTACAACTACAACTACACTAAGACAACAACAT
GTCAGATGCTCGGTTGAGTGTCTTGACCAAGCCAGAGAAGACCGTGCCGGGCGGACTGGAGAAATTCTCCGGAAAGCAGCTACTTGGAAAGTCAAGCTAC
TCACGCACGTGGCCCAATTCGATTTGGAGGCCGAGAACAAGCTACTCGAAGCCGGTGACCCGGGCCCGAAGGTCTGCATGAGGGACTTCTTGAAGTCCAC
ACCGACATGTCTTACGGATGCAACCGTAAAAGCAGCTCCGCCCGAAGGACAATTGGCTGTCCGGAAGGATATCATGGTATGGCGCAAGGCGGACGCATCG
ATGAGGCATGTCCTCAACTCGACCCTCCCAAACTCGTTTCTCTCGTCCCTACCGGACGAGGTGCGAAACATGGAGGTGTGTCTCATTTCGCAGCATCTCG
AACGGAAGTTTGCGAATGGTGATGCTGGAGGATTGGTGGCATGGTCGAATCGGTGGACTCAGATTCTGAACTCGAAATGGAAAGACATCATGACCCTGTT
CGCGCTGCTCAACCAAGCGCGAACGAGATGAATCGGAAGTCTAAGAAGCTCCTCGGCAAGGAGATGATGACGGAGACGATGATGTGCCTGCAAGTGTTGG
CGCAGCTCCCAAGCGAGATTTGGACATCTTTGATTGAGCTCACGGAGGAAGCGCTCACCGCCGAAAAGGTCGAGGTGGCGCTGAACAAGCTGTTTGGTGG
CCGATCCCGGAAGCAGATCACGGGAAACGGCGATGCGACAACGGTGGCGCGCATAAGCCATGCCAAGAGTGAGCGTGCTGTGCGTGGATACGACACAAGG
AACGCAAGTCAGATGCCAACACCAAGGTTCAGGACGAAGAGTGTTTCTAGTGTTTCGGCCAAGGATATCAGAAGGCGCAATGCGAGCGCATGAAGGCCGA
CCGCGACCCAAACTGTGAAGGGGGACCGCTTTTCCGCACCAACGTGCAAGCCCAACTTTCCAAGCGGGCGCCCAACGGGACTAAGAATATTGCCACGATG
CAGCACGTTGCCAAGAAGCAAAGGACGACGCGTGACGCACCCACGGACGTCGAGATGGAAGGAGCGTTCAAGCTACCCGAGTCGGAAAAGGCCAGATCGG
AAGACGAGAATGGAGGCGGTCTGCTGAGTTTCGGTCAAGTCGACACCAGGGTACGTAAGAAGTATGGTGCTTACTTAAATTGGCTACGGCGATTAACAGT
TTCGGATGGTCTGTGGATTGTTGATACAGCAGCTGGACTAGGGATAAGCCGGGACAGGAGATGGTTCGAATCTGTCCACACAGGTTCGAGTCACCAGTTT
GAGTATGGAAACGGTAGCACGTCGGAGACTGCTTTAACGGGTTCAATACAGATGCATATTACAAGTCCTTTCAATAAGTCTATCGGTTTAAAGATAAGGA
AAATTGCTCTCGATAAGGAATGTGGGAGTAATTTAATTAGCGCTTATCGTCTAGCCAGACAAGGTTACAATCACGTTAAATCCCGAGATGGGGAGTTTTG
TATTTTTTCAGTGAGAAAGGGCAGCTTTTATTTGCAGCCGTTCAAAAGGGAGCAGTATATTATATGCCTTCATCTAAGTACAGCAGAGTTAATGCAGTAA
GAAAAAGTTATACACAAGCTCAGAAAATAGCTTTGCTGGAGAAGTGGCATCATAGATTAGGCCACGTTCACAAGGCCAGACTTTTGGCAATATTTAGCAA
TGGATTAGTTGAAGGAATTCCTCAAATTCCTCAAAAGGATCTTCCTTTCTTTTGCGCTACGTGTGAAATCGCAAATTCCATGCGAATGTCATATCGTAAT
AAAATAGGATCAAGAAGTAGGCCACCATTGCATGCTTTACATATGGACACCACAGGAAAGATAAAAGTGAATGGAAGATGTGGCGGTTTTGGTTACGCTA
TGCATTGTCAATTGTAGATGATGCAACGTCCTATAAGTGGGTGTTTGTCATGAAATCGCCAAAAGAAGTGTATGGTCACGTTGTGAATCTCGTACGTCAA
TTGGAAAAACAGTATCCGTATGAGATAAAAAGAATTCGCAGTGACGGTGGCAAAGAATTTGTAAATAAAAGAGTTTAGGCGTTTGCAAAATCTAACGGCA
TGTTATTTGAGAAATCTAATGTAGACTCTCAGGAAGAAAATGGAAGTGCAGAACGTTGTCACCAGACGCTAATGAAACAAGTTAGGAGTGCACTATTAGC
GGCAGCAATGCCAGCAAGTTGGTGGCCTGAAGCCATTAAGTACGCAGCGGAGGCATCAAATAGACTTCCAACATCTAGACTTGGCCACACATCGCCATAT
GAGGCGCTAAATAAGAAAAAGCCGGATGGGAACATTTTGCAAATTTGGGGTAGTGTTTGCTATGCTCACATTCCGAGTACCAAAAGAAAAGATAAGAAAT
TAAGTTCACGAGGACTAGAATGCAAGTTTCTTGGAATTGCAGAAGACTATAAGGGTTGTAGACTGTTAGATACAGCTAATAATGTTTTGCTGATCTCTAG
AAGCGTAAGATTCGATACAACCGACCAATTAGCAATTATGAGAAGGTCGTTTCCTAAGCGGGATAAACAATTAACCCTGGACGAAGTAGAGGAAATTGTT
GAGTGTACCACCAACGAGGAAGAAGACGAAGAATTAGAATCAGAAGAAGAGGAAAAGGAAGACGAAAAGACGTCTAAATCACCCCAGTCAGGAAGTGTGG
GAGCTGTGGGAGATACTATTTCTTCTTTTGACGTCAATGAGTCAAATGCTAGTCACAATGTACCTTCCACACTTGGTATAAATAGTCCACCAACTTTCGT
CGGACTGAAGGAGGAAAATACGGAAACAGAATGTGCAAAGCAGCATACGTTGCCGCGCACACTACGTAAAAGACGGCGCAGCCCAAGGCCCAGTGGGTAT
GAGGTTAATATAAACCGAATTTTAGGCGTAAAAGTTAGTAGGACATGCATTCCTATTCCTAAGTCACTAAAAGCGGCTATATCAGGGCCGTATAGGGAGA
AGTGGCTGGGGGCATTGGAAGTTGAGCATAATGCTCTAATTGCAAATAATACCTGGAAAATGGTAACAGGACGAAAGGCATTACGCTGTCATTCGGTCTT
GGATGTAAAATATAATGCAGATGTATCAGTTGAAAGATTCAAAGCCCGATTAGTTGTAAGAGGGAATCATCAGACACATAGAATAGATTACGGTGAAATA
TTTTCGCCCGTGGCTCGCTATGAGTCACTGAGATTAGTGCTTGTAATTGCAGCAGTTGCGGATTTTCATATCCATCAGATGGATGTGTCCACCGCCTTCC
TAAATGGCGAATTGTTAGAGGAAATTTATATGATTCCACCACAAGGATTTAGAAACAGGCATAATGGAAAAGTATGTAAGCTACTGAAAAGCCTATATGG
ACTGAAACAGGCACCTCGGATATGGTATGGGGTCCTGCATAAGTTTTTTACGTCATTAGGTTTTTCTCGTTGCAAAAAGGAATACTGTTTGTACAAGAAA
AAGTGGGAGGTTGGTGGAGTAACGGATGTTGTCCTAATATGTGTATACGTGGACGACCTCACCATTGCCGGATCTAGATTATCCGCAGTGAATGAAATTA
AAGCGAAACTATCTGCACGCTATAATATGAAAGATCTCGGTGAAGCTCATTATTTATTAAAGATGGAGATCAGAAGAGATAGGGCAACTAGGCAACTTAG
TCTATCACAACATAAGTATATCATGGATTTATTAGAAAAGTTTGACATGATGGACTGCACAACGGTTGCCAGTCCACAAGCAGCGAACATTGTATTGGAA
AAAGAAACTAAGCTTAGTGCTGAAGCCATTGCAGCGCAGCCATTCGACTACCGTGGACTGGTAGGACCGCTAGTGTATCTGATAAGAGGAACTAGGCTAG
ATATTGCGAACGCTGTAATAGAATTAAGTAATTTTTTCTCTCGTTTAAATATGTCAGATTGGAAAGCAGCCCAGCGATTACTTAAGTATCTGAAAGGAAC
ATCGATGTATGGGTTAGTATATGAGGGTACTAACAAAGAAGTAACGTATGAGCTATCTACAGATGCGAGCTTCGCAAATGCTAATGAGGACCGTAAATCA
GTTACAGGTTACGTGTCTATACTCGCGGATGCGTGTGTATCATGGAAGAGTTGTAGACAAGAGATGGTCAGTTTACATACAGCACAAGCTGAGTTAGCCG
CCGTAAGTGAGGGTATTAAGGAAAGTGAGTGGCTCTGGTTATTGCTTAAAGATTTAGGATGGCAGCAGAAGCAGCCGATATATTTTTGGTGCGATAACAC
AGCTGCTATAAGTATTGTTAAGAATCCTGGAAACCATTCCTCGACAAAACACATAGAGACTCGATATTTGTATGCCCGAGAAGCTTATGAAAGAAAGCGC
ATCGATATCATGTACTGCAATACAAAAAATATGGTGGCGGATGCCCTTACAAAGGCACTACCACAAGAACAATATTGCAAGCTACGTGAGCTTATGGGTG
TGAGAAACTTAGAAGTTGAAATAAACAATGAGAGTGCGTAGTAACCTTAAGGGATATTTATGCACAGTGAGGCGAGGCCGATGAAACCTTTATCGCCCAG
GGGGGTTCGTATAGCGCAGCCCAAGACTTTTCCCAGGGGTAGTGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAG
GAAGCGTAGGTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGTGTTTTGGTAAAAGATGAGGACTGCTA
TTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCCGCCAACGGCTGGTTGGTAGAATTCCAATGCTATGCATGTCGCTCA
TTGGCTAAGAGATGATGCTCTCAGCCAATAGGAACCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCTTTTGGTGTGTCTACA
CCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTATCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCC
CCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAATTTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCC
GCAATGAGCTCGCCGCAGAAGAAGACCGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGCCAGCAGGCAAAGCGCGATGCGCTCG
CTGCAAAGGCCGCGTCGGGGACAATCCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTACGAAGACGACGACGTGGAGAT
GGAAGAGGGCGAGGCCTCTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGAC
TCGGACGCTTCGAGCTCGAAGCGTTCGCGCAGCGAGAGCGACACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGTCTTCAAGTT
CTCCGCGCGCTGCCTGATCAGCGCGCGATCGATGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCAAACGAAATCCCGCT
GTACGTATGTAGCGGCATCCACGACGATGCTGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTATTACATCGGGCTCTTCCAC
GAGCTCCGGTACTTCTCCAGCAAGAGGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCA
ACAAGAAACCGGCTGCTTACCGCGAGCGGGTTTAGCATACCCGTGAACGCTTCGAGACATTCTCGACGCGCGGGAGGTTGGAGCAGCTCCACAGATCTTC
TGTGGACGCTGGTATTCCATGCGCTGTGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGCGCGCTTGAGCGACCGCGACCTAAACGGGTAC
ACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGTGAGGAACGCGACGATCGTGGGGCCTCGGGCGCTGTAGGTGACC
ACAGCGCTCGCACTACCTTCGCGTCAGCAGTGCGTGGTGAGCTTTGTACTCCCTCACCATTTCCGGAACGTCCTGCAGCAGGACGTCCCGTGGCTCCCAT
GTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCC
AGCGTGTTGAGCCGCGGGCGTCGCGGGTCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGTATGGTCAACCTGGGGTTGACCTTGGCCCGACGCTCGAGG
AGCGGGTCGCTGCTGTGGAGCAGCTTCAGAGCCGCGAGTTCGCCGCGCTGAAGCAGGAGATGACGACCCTGAGAGATCAAGTTGCTCAGGCCTCGCAGAC
CGCGCCGGACATCTCTGTCGACGTGGGAGGTCGCGTCGCACGCTTGGCCCAGCGCGTTCACGCGCTGGAGCAGAGGTTCGCTCCCGCTGGGGCTTCCGCT
TCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCCGGTATGGCTTCAGCCGCCCGACGTAAAATGTCGGGTGGAGGCGCATGCTAGATGGAATATCTAGTGT
GCAGGCGTTGCCATGCCGTGCCAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGCTT
TGAGTTGCTAACAAAACCAATGAACCCTTCTTGAATTCATAAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGAC