Description :
From Genome Similarity Track
Location :
scaffold_60:37150- 39981
Sequence
2831 bases(100 bases per row)
TCAAGCCAGTACATATACCTTTGGTATCGAGGAAAATGTACCGGTAAACACCGTTGTTGGTTCCGTGACTGCTATTGATAGTGATACGTACCAGAACAAG
ACCATATCCTACAATATTGTCGATGGAAATGACTATGGTGCATTTGGAGTTCTATCGATAGCAGGAGACGGTAGAATTATCGTAGCTTCGCAGCAAGCTC
TCGACTTTGAGCGCCAGAAGCAATATTCACTATTAATCTCAGCAACCGACAGCGGTATAAGCGGGCTCTCCACTTTTGTGACAGTGGTTGTGACTATCAA
GGATATGAATGAAGCTCCATCAGCAAATCCTTTGACTCTCTACATTCCTGAAGATGCTACCATAACTACCGCACTGTACACGACCCAAAATCTCAACCAG
ATATTCACGGGAACGTTTTTTGCCTCAGATCCAGATAGTAACGACATATTGACGTTCACGATTCTTGACACGACGGATACGTTTGCTATTGACCCAACCA
CAGGTGCTGTGTTATCCCAGAAACTCCTGAATTTCGAGCAAAAACCATATTTTACGATATTTCTATCGGCATCAGATAGTGGCAATCTGTCATCGGTGGC
GATGGTGAATATCATGGTTTTGGACCGCAATGACGCCCCAGTCATCTCTTCCACGGCATTTCTAGTTGTTGAAAATGCAGTTCGAGGTTCGGTTCTTGGT
GCCGTGGTTGTTACAGATGAAGATTACGACCAGAAGCATGTTTTCACTTTGGTTGAAACCACACTCCTGTTGTGGGATAATTCGTCGAGTACTAGTACAG
ATGCGGTTTCTGTTGATTTCAATTCTGGTTCAGTTCGTGTTGTGAACGAAACCATTTTCGATTATGAGATGGTTCGCCAGGTGATAATAGTGATAACGGT
GAGTGACGATGGAAACCCTATTAGGCAAACGACGAAGCCATTAATACTTGATCTGGAAAACGTGAACGAGCGGTGTTTCTTCATTCAGCCGTCATTCGCA
TTTTCGATGTCCGAGAACAGAATTGGTATGGGTGGACAAGTACTTGCAATTGATCCAGATATCAACACGTCGCGATCGTGGGGCTCACTGGACTACTACG
TCATTGATATCGAAACGTCGAACTCTGTTGTTTCACTGTCGATTGAGGGTAAAGTCCTGGTAAATTCACCTTTGGATTTTGAAACTCTGCGGAGGGTTTC
GTTTAAAGTTGGAGCAGTTGATGGTGGCGGCTTAACCTGCTCAGCTACTGTGGAATTACTGGTTGAAAACGTGAACGAGGCTCCAACTATACAACCAGGT
CACTTTTGGGCGCTAGAGTCAGTCGACGGGAGTCTGGGTCCGGTAAAGGGACTCGGTGAAACCCAAGCTCAAATATCATTTTGGGACCCGGAAAATGACT
CAGTGACAGTGTCACAGAATTCATCTGACTCTTTTTCAATCTCAGGCGAAGGGGTAATTACTTTAGTGAAGCCAGTTGACTATGAAGCGAAAACTTGGTA
TGATCTTCTAATTATCGGTGTCGACTCTCATGGACTCCAGACGAGCTCTATAATCCGCGTTGATATTATAGACGTGAATGAACCTCCAGTTTTTGTTTCA
CCCCAGCCAATGATGGTTATTGCCGAAGATTCTTCAAGAGGTGCTATCGTTGGGGCAATTGCTGTCGCGTATGATCCTGACGAATTTGATGCTATATCTT
ACAAAATTGAATCAGTGACAGACCTTAACGGTATCTCCGTGGATATCTTCACGATTAGTTCATGCAATGGCGAAATTCGGATGAGCATGTCGAACGCTCT
CGACTATGAAACTAATAGTGCGTACTCATTAACTCTGAGTGCAACAGACCGTGCGGGTTTACAGACGTTCGCTGAGCCTATTAACGTGCAAATTTCCGAT
GTTAACGAGATGCCCCAGTGCCGCAGTACTACCTTATCGATAGCAGAGACTGCGACTGCAGGTGAAAAGTTAGGCCCAATTATGTGGAACGATCCGGATT
CAACCAGCAAAAACAGTATAACGGTATTTGAGGTGGACGCTGATACTGATGAAGCTAACTATCAAATTTTCGAGATTCAGCAAATTAACACTCAGTACTG
GCTCGTACTCCAGCATGGGGGATCTCTGGACTTCGAGTCTGTAAGTCTTTATAACGTGCACGTTAAAATTGGCGACAGCTTCGTATCCAGAAACGAAAAG
ACTGGATCAGCGACAGTATCATCATTATCTTCGGCTTGCACTATCACAATTCATGTACTCGATATCAATGAGCCACCTGCCGTTGAAACTGTGATCAACA
GAGAAATTGAGGAAAACTCTCTGATCGAAGCACTGGTAGGCCTACCAATTGAAGCAACGGATCCAGATACACAAGACGTTATCAATTTCGCAATGGTGAC
TCGAAAAGATACTCTGATTCCATTCAGGATTGACTACAAAACGGGCCAACTTTATGTATCGGGGGAATTGGATTACGAAACGCAGGCATTGTACAGATTC
AATGTTACGATAAGCGATAGCGCGCAAAATACTGTCACAACAGTGCTCCAAGTCTCTGTTCTTGACATCAACGAGAGCCCTCTACTGTCACGAAATTGCT
TTGTCCGCGAAGATGGCACCTCTGAAAATCGATACGAGAATAACAAGCACGTGTGTCTTGAAGCACAAGAAGATATTGCACCTGGAACAGTGCTACACCA
CTTTGAAGCTTTTGACCCAGACAGCAACCAGCGCTTATTTTATCGTTCGGTTGACACGGCTAACCTGATTTTTCGAATCGTGCAAAATGACGATAGAAGC
TGTGAACTTGTGTACAGCCAAGCCGTCTTTG