Description :
From Genome Similarity Track
Location :
Scaffold_826:3715- 7871
Transcript NameFunction/comments
g14758.t1OWZ10245.1 reverse transcriptase, partial [Phytophthora megakarya

Sequence
4156 bases(100 bases per row)
CGACCTAGTCGGGACGAAGACCCGGACGATCTATTTGACCTGGACGACGGCGCTGCAAGGGAAGCGGCCACGGTATCGGCTGCGACGGTTGGCATGGCGA
GCACCGGGATGACGCGAGTACGCCTGTCAGCGTTCTCCGAGCTGAAGGAGTTCCATGGACGAGATTCTAGCGAAGAGAAAGCCCGAGCTTGGCTAAATCG
GATGAAGTCCGCGTCAAGACGGGATGGAATGACGGGCGACGAAGTATGTGCCTTGTTCGGAGATCTGATGGCAGGACCCGCCCGCCAATGGTATTTGCAA
CTGACCCGAGGAGTCAAGACATCTTGGACCGACCTAACGGAGCAGTTCCGCATCCAATACTGCGGTAAGGGTGTGTCTATGGCGAGCCGATATTATCATG
CAGCCAAACACCCCGACGAGACTCCACTTGAGTACTTGTACCGGTTGAATGTGGCAGGTATGCGGGCCAAGATCCGCTACGACGATGGTACCGCAGAAGA
GAAACGGGAACACGTGGAGTTGTTCATCAACACTCTTGGCTCGCAAGAGCAAGAGTTGGCCTCTCGGCTAACCCTGATGGAGGTGCCCGACGTCGAAATA
CTGGAAAAGAAACTGCGTGCTCGGCAACGAGGTCTGGCTCATCAGAAGAAAACTCTGTTCGGATCCAACAAGTTCCGCCAGAAAGCACCAGCGCCACCTC
CACCTGTTCGCGCAGTTCATGCGATCCAGACAGCCGCCGACGAATACGACTCGGGACGTGATGCTCAAGACAGCGATGACCAGATGTACGACCAAGATCG
GGACGCCGAAGAACGGGCCCGACTGTTCGTAACGGGCCCGTCCCCGCCAGGCGAGAACGCGCGTCATAACCTCGGCGCAGAAGACGCGGGACGAGGCCGT
CTCAGATGCCATCACTGCGGTTCGCGTCGACACTCTGAGGAAGACTGCTGGGGTTTGATGACGTGTCAGAAATGTGGAGGTCATCACCCGACCGATCGGT
GCTTGCGAGCGTGCAAAGCTTGCGGAGAAGTCCACGAAGCGGGAAAGTGTCCTCTGGAAGAATTCTTCAATCAGCTTCGTCAATGGTACGATCCACAGAA
GCACGCCGGAATGTTGCCGCCTCCAGCGGAGAAGATGTTAAACTAGACCGCTCGCTGGCGTGGAAACCAGTACGAGACGAGCGATCTGTTTCCGTCTATG
CATATGTGGCAAAAAGACCGCAAGAGGTGGCTAGTGAAGACTCGGCCGCCTTGATCGATAATATATGTGAACCTGACCAGGGACCTACCCCATGTGGACG
TGTCCCCCGAGTGGCGAACGTACGATACTCGAGCGAGTATGAGAGGGAAGCCCCGCTGGATGTGATTGACCTGCAACCGGGAGAACGGCGCGGATACTGG
AAACATTACGCGCCGGATAAATGGTATCGACAGGCCAAGATTCACGGGAAGCTGAATAACCGCCGTGCAACGTTGCTGCTCGACACCGGTGCCGAGGTGT
CCATACTGGACACCACCTTTGCTCGTGAGGTAGGCTGCCGGATCGACACGGATGTGACGCAGAACTGTGTCGGAATCCGCGACGAGACGTACTACACGGT
GGGAAGAACAAGGATTAAGGTCACCCTGGCCGGAAACTTGGTCTACTTCCTTGATATCTGGATCGGAGAATTGGTGGGTCAAGACGCGATCTTGGGAATG
AATTTCATGGTGCCAGCCGGAGTGCGTATTGATACTGCAGACGGCACGGCATGCTTGCCCGACGAAGTCCGCGTCCCGATGATCGGACGTAGACCGCTGT
ATGGGGCGAAGATGCGGCCAGTCATGGCACCGACGTCCGAAAGGATTAGTCCGGGGAAGTCGTACGATATCCGCCTTCGTCCAGATAGAAACGCTCCACG
ACTCTGGGTCACTAGGGGAAGCACGTGGGTTACCACTGTTGTCAGGAGTAAAACTGGACGATGGACGTACCTACGAGTGACTAACATCGCCGACAAGACG
ATCATGATCGACGCTCACATGAAGCTGGGGTGGTGGACGCCCGCCGATGCCCTACCACGCGACTTCGGATTCGTCCAGGTTAGCTCGCGACGCTATCAGG
AATGGCAAAATCTGGCGTACGGTGCCTCCTGCGACGCAGACGATCACTGGTCTAGCGCGGACGACATGGAGCTCGGCGAACCGATGACGGAACGCCCGAC
GTACGAGATCCCGAAAAGGATTATGCGACGGGGAGAAAGCACGAGACCGAGTTCGACGGAAGAGCGAGAACGGCCACCGCGAGTGACGGCAGTAACAACT
GTACCTGAGCCAGAAGGCGACCTCGGAAAGGCACGTGAACGACGAGGCGAGACAGCTCTGAAAAAATCACAGAGTGACGAAATACAAAATGACAGCACGG
GGATGCCATCGGGAAAGGCGGAAGAGACGGATCGTCTAAATCAGGCGACCAAGAGTCAAACTCACGACGTTGAAGCCGAGGAGGCAGTATTCTTCCATGA
AGGATCGGAACTCTTTGCCGAAGAATTGCAAGCTGAGATGGCGATCCTTCCAGAGATCTCTCTGACGAAGGAAGTAAAGATCGAAGATCTCAAGGTCGGA
CGACCCACCGGGGTCGCGCCAGAAATCGCGGCGAAGCAGGAAGAAAGACTGCGTCGCATCATCTGGAAGCGGCGGAAGTGGCTGATCGGGAAAGGAAATG
CATTACCACCCGCAGCTGTGGGAGTTGTCTGTGACATCGATGTAGGCGACGCAAAACCAATTGCGCAACGGGTCCGCAAGATACCTCCTCAATTCCGAGA
AAAGGTCTCCGACCTGCTCAAGGGGCTCCTCAGCGCGAAGATGATCCAGATATCGAAATCTTCATGGGCGTCGCCCATTGTTGTGATTGTGAAGAAGAAT
GGGACTGACATAAGACTCTGCATCGACTACCGATTGGTGAATGAGCTGACGCAACTGTTGGTGTATCCAATGCCGCTTGTCAATGACCTACTTGAAGACC
TCGATGGATACCTGTGGTATTGTTCCCTCGACATGGCCAGCGGATTCTGGGTGGTTCCCATGACCGATCGAGCCCGACTCGTCTCAGCTTTCATTACCCC
GTTTGGGCTGTTCGAGTGGCTTAGGATGCCGTTCGGGTTGTGCAACGCGCCGCAGATATATCAACGACTGATTGACAACGCGCTCTATGGATTTTGGAGC
CTCTCACCGAGCCATGATACTCGGGACGTCTTCGACAAAGGAGACCCAGTAACCCCGGGTTCCCCATCCGTCTTAAGTCGACGTTCGTATATCGATGACA
TTCTGATCGGCGGTACGACGTGGGACGACCTGTGCACAAAGGTGGAACGTCTCTTAGATGTCTGTGAGCAATGGCACCTGTCCATCAGTGTGGAGAAGAG
CGAATGGGGAATGACCCAAGTCGGGTATCTGGGCCACAAGGTATCAGGGCATGGACTTGAAGCGAAGCCTAAGAACTTGGAGTCGTTGACTACGCTAGCC
TTCCCGCACACGCTCAAAGGACTCCAATCTTTCCTGGGTAGTCTTAACTACTACCATCGATTCATCGCTGACTTCGCGATTTATGCGACCACGCTATACG
CACTCACGGAGGCGGACTTCGACGAGTACCCAGATAAGCCGGGGGTGCATTCACAGCCGAAGTGGACGCATGCCCTCAACGCGTTCGAGAGCCTCAAAAT
GAAGCTGGCCCATACTCCGATGTTGAAACATTTCGACGCGACGCGAGAACCGGTTGTGATAGTGTACGCCAGCGACTGGGCGATCTCAGCGGTCCTAACT
CAATCTCACGACGATGTGTACATGCCAGTGAAGTTCACTAGCCGCACGCTGAAGCCCAACGAGCTCAACTATAGCATCGTCGAGAAGGAGATCTTGGCGC
TCTTGCGGGTTCTGAATGACTGTTTCGCGATGCTGGCCGGGAAGACGATCCGCGTTTTAGTCCGTCACACGACGTTAGCCTGGCTGTTTCGATCCAAGGG
CCTGCAGGGGCGACTGTCACAGTGGGCCGCCATCCTATCGCCGTGGAAGTTGGACATCTGCCGGTCTATGAAGGGAGAAGAGGAAATTCTCGGAACGTTG
GCCGCGAGCATCACGCCACGAGCATATGTCGATTCAGCTCTGGAAGAGATCACCCC