Description :
From Genome Similarity Track
Location :
Scaffold_112:37147- 39024
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_112-fgenesh-gene-0.9Translocation protein SEC63

Sequence
1877 bases(100 bases per row)
GCGCTTTACtGGTCCTTCTTGCTCTCTGGCGGCTGCTCATCCTCCTGCTCCTCTTCGCTATCACTCGAGTCCTCGGGGTTgATCATCTGCTCGAACAGAG
TTGGCTCGTTGTCGAGTTCCAAGTCCTCTGGGTGTGGCTGGTACACGGGGAGTGTCGACTGCGGCACAACGTTGAACTGCACGTCACACAACAGAAAAAG
TTAGTTTACGGTCCGCACGACTCATCAAATAGCCATCATCATATTCGTACCTTCGCAAGCGCACGCAGGTCAAGACCGACGTACGAATCACACTTGACGA
AGATGTCAAGCTGGTAAGTGCCAGCCTTTGGCGGCGCCTGCAGCTGTAGCTTGAGTTCGCCTTCACGCTCCTGGGACGTAATCTTGCCCATAGCGTGCAA
GTGGTTGGTCTTGACATCACCAATGACACAGAACCAGCGCTCCAGCTTTGGGtATGGGAAGTGTGGAGCGTAAACGAGGTCACACGTGTCGCCCTCCTTC
ACGTTCTTGCGCGTGAGCTtGATGGTCACCGTCATGATGTCACCCTCACCAATTtCCtCcTCATCCTCAACGCCAATCGTGATCTGAAGATCCATGTTCG
GCAtcATGCTGCACACGCTGTTAACTTCAGCACGCTCGGCATCCGAGAGCGAGCTcAAACCCTTGCGCTGGtcGGCGTCCATGTCGACGTACTGATGCAT
GCTACGCaCAGCGTTCTTGCCGGTGATGATGTGTCGCACCTCGTCCTCCGTGATGTGTGGCAGCTGGAGGAATGGTGGgTCCTTGAACCAAAGCGACTGC
GTCAAGAACTGCTCCATCTCAATCAGGTTGAGCGTCGTCTGCAGCCACGACTTGCCGACCGAGATTtCCATCATCGCATCAACAAGCTGAATGCTCTtCT
TGAGCATCTCGTTCAAGTCAGACTTAAGCgCAGGGCTGAGCTTCTCACGCAGGAAGTGAGCGTGGAGGAGAATGTTGGCCTTAGCAATCGATGGGTGGTT
GAAACGaGGCTTCGCAATCATTTCCGACTGCTTAAACTTCTTGAACAGACTGCTGAGCTCAGCATCATCAGTAGGACGACGCTTGATCTCACGGAATTCG
GCCGAACCAGCCAGGATCTCTGGCAGCAGACGCGGGTGtGCGTGCTCCGACATGGCGAAGTTGTAGAAGCCGTACGTGTCGTACATGATCATGCTGTCAC
CGTACTTCTTCGAGTGCGAGTACCAGAGAGCGACGCACGATGGGATCGCAACGACCAGGATGATCAGGTACAGGAAGAGCACGATGTTGTGGTTGGCTGG
GTCAAGCAGGAACGTTGGGAGACCAATCGAGAGCTGCAGTGCCTGACGACCGTCTGGGTTGCCATACTTTTCGTAGTTCGCCTTGGCCACTTCGTCCGTC
AGAGCTTCGTACGCCTTCGCGACAaGCATGAACTTCTGCTCGGCAACAGCGTCACCAATGTTCTTATCGGGGTGATACAGGAGCGACATCTTGCGGTACG
CGCGCTTGATCTCCCGCTCGGACGCACCAGCAGCAATGCCAAGAATGGCAAACGGGTCGAACGACTTGATCTCCGAGTCGTCCTGCAACAAGATCGCGGC
ACGGTAAAGTCCGTACCACATGACGGCCAGCACAATGAGGTTGAGCACGAAGAAcGGCGAGAAGACGTTCGAGAGCTTGGTCTTCTCCGCCAaCATCTGC
TTCATCTTGCGTTTCTCCTTCTCGCATCGAACATTGGTCATGTCAATGAGCTTCTCCTTGAGGAAAAGACCATAGAGAATACGGCGCAGCGAGAGGAACG
TGATGGGCACGACGTAGAGCACGCCGACCGAGACGGAGAAGTAGTAGAACGCCGAGTTGTCGTACTCCAACATGGCT