Description :
From Genome Similarity Track
Location :
Scaffold_47:37145- 39822
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013065Similar to fam119a: Protein FAM119A (Danio rerio)
Pytul_DAOMBR144PYU1_G013064Similar to eif2a: Eukaryotic translation initiation factor 2A (Dictyostelium discoideum)

Sequence
2677 bases(100 bases per row)
CGCTGTACCTGCATCGGTAGTATCATCATCGCCGTCGTCTGTACGATGCGCATTCGCCATCGTCTCTGCAGCGTTTCGCTGCAAGTTCTCCATCGTGTAC
TCGAGGTCGGTCAAGATCACGTGTTTCGCGCCGAGCAGCGCGGCCGAGAGCCCGACGAGACCCGTGCCAGCGCCGACTTCGAGGATTCGCGCCCCCTTAA
TATCTGCAGCCCTTGTATGCTCCAGGTACTTCGCGAGCACAATCGAGCCGTCCCACGTGGTCAGCCCCGTGCCTTTCCCCGAGTTGCCGATTTCCCCGAC
AGACACGACGTGGTCGCGGATCGAAAACACGGTCGAATCAAACAGCTTGGACGGCAGCGCCAAGTGATTCTGCTGCGCGCCATCAGTGCGACGGAGGATC
ACGTTCAAACGAGACCGCTTTGATGTGAGCTGTGAGACGGACTGCAAGCGCACAAACTGGTCGTTCCGCGCATCGTAGATCTCGACGTCAATCTCGAACG
GCGACTGCGCGCGCGTTGCAGCATCTTTCTCTGGCTCTTCTCCATCTGCTGCAGCCATGGCATTTGCAAGTGCTGTCTGCAGCGTGTTATGGAACGCGTC
CATGTTTGACGGAGGCTCGACTTTCAGCGTCATGGGCGGCAGTGGCACCGATCCGACGTTCTGCACGTCGACTCGCAGCGTCAACAACGTCTGTGGGGCG
GTGGCGACCATGGTGCTAGCTGCATACACTGCAATGACGAAGAGGCAAGAAGTGAATAAAAGTATATGCACAGGAATCAGTCGCGCGCGTGCTCGGCCAG
GCGTGACGAGACGAGCGATGGGCTTCTTCCTGCTCGTCCCCATGAACGATCCACAAATGGGAGCTCTTCCCGAATGATCTGGAAACCGCTAAGTGCGGCT
CTGTCTTACAGAGAAAAGTGCGCTTTTCGGTTTTATCAGAAACTGTCGCGTAAGTTCGCACTTTCGATAAGTTCGATTTTAAAGAAAGTTTGTGTTTCGG
TTTTAAAAGAATGTAATGTTAAGTTCGTGGTAGGTTAAATAAGTTCGATTTACGGTTCTAAGAGAGAGCACGGAAGCTTTGGTTGGAAATGGGCTCTCCA
GAGTGACAGCCATAACCAAACGCAGCAGCACAAGATGGCAGCAGCAGGTACGATCGGCGCTCCTTTGTATGGGGTTTACGGCGTCTGTGGGTGCATGCAT
ATGCATGTGCACAGTCGGCAAGACGTCTTCTGGACACACATGTCAGCGCCCCAGTAGTGCGCTTTCCACCCATAGCGACGCTGCGCCATCCAAATGTCAA
CGAGATCTATGGTCGCTCATGCTGTCTTCTGGTCCATTTTTGTAGTCAAAGAATCGGTGGCAGAGTTGCTGCGCACCAAGTTTTTCCTGCGCGGCAAGCA
GGGCGTCGAGGCGCTCTGGGGGCTGCCGTCATCCAGCAAGGAGCAGGGCCAGGTCGAGAAGGATGAGTCCATCGGCGCGCCGCAGGCCGACCTCATGGAG
TTCAGCGCTGACGGTGCCAAGATCGTGCTCGTCAACACGCAGCTCGGCTTCACTGTGTGCAACACCGAAGAGTACGTTGGTGCTTGCGCGTGTATAGTCA
CAATGTTTGCTGTGTGTGTGTGTGTGTAGCTCTCTAATGCTTGCTTGCGTGCTTGATTTTGTGGTGGTGCTGTTAGCTCGGAGGTGGTGCTCGAGGTGTC
CAACCCAGGCATCCAGGCGATCGCGTGGTCTCCGCTCGGTAGCCACTTGCTGACGTGGCAGCGCCCACAGAAGGAGGCCGAGCAGGGCAACCTCATCGTG
TGGGACGCCACGACCGGCGCCGAAGTCGCGCGCTTCAACCAAAAGTCCTACTCCAGAGATGTAAGTTGTCGCTGCATTGCCTTTTTTTCTTGATTGTAGC
AGGTCAGTGACAGACCCGTTTGCTTGTAGAACTGGCCGTCGATTCAGTGGTCGTCGGACGAGACCATCTGCGGCCGTCAAAGCGCCAACGGCGTCGTGCT
CTACTCGGGAACCAACATCGCGGCCGGCAGCATCGGCCAGATCAACTTGCCGAACACGACCAACTTCAGCGTCGCGCCGGGTAGCGCGCCGTACAAGATC
GCGCTCTTTGTGCCGGAGAAGAAGGGCAAGCCCGCGAGCGTCAAGGTGTACCATTTCCCGGGTCTCGAGACCGTCGTGGCGTCCAAGAGCTTTTACAAGG
CGCAGGAGGTGAGCATGAAGTGGTCGCCGAATGGCAGTGCGCTCGTGATTGAGACGCGCACGGATGTGGACACGACGGGCAAGTCGTACTACGGCGAGAC
GGGGCTCTTCTTCCTCCAGAGCGACGGCGCGTACGACTGCATCGTGCCGCTCACGAAAGAGGGACAGATCCACGACGTGCAGTGGGACCCGACGGGGCGC
GGCTTCGTGGTGCTGGCGGGCTCCATGCCGTGCAATGCGACGCTGTACGACAACAAGGCGATCCCGATCTTCGAGTTCGGCGCTGCGCCGCGCAACCATG
TGAGCTGGAGCCCACACGGCCGCTTCCTCTGTATCGCGGGCTTTGGTAACTTGCGCGGCGACATGGACTTCTGGGAGCGCAACAAGCTCAAGAAGATGGG
CTCGGCGAACTCGAACTCGGCCACGACGTTCGCGTGGTCGCCCGACTCGCGCTACTTCTTCACGGCCACGACGTTCC