Description :
From Genome Similarity Track
Location :
Scaffold_13:371415- 376130
Transcript NameFunction/comments
Physo_130882hypothetical protein
Physo_130883reverse transcriptase

Sequence
4715 bases(100 bases per row)
GACAGTAGTCTTCACGGTCATCACGGTCTTGTCAGCACCGTGGTCTTCTTGACCTTCGCGCCGGCGCGAGGTCCCACCGGTGGTCCCGTGGCGTGGCAGC
AGCGATGGCCGAAGGAACTGGGTTGGCTGGTACATCAGCAGCGACTTCGCTGCGTGGCTCTCCTGACGGCGGTTCGCAGCGGTTTGACTCGATCGCAGCG
GCGTCGAACGCCTCGGCGCTGAGTTTGCGGCGCTTGGAGACGAGAGCACTCAAAGTCTCGTGAGCACAGCTTGTCGCGTGGCGGCGCTTGCTCGGGGGAG
ACGGGTGCATGGTTGCCTAGGCGGTGAATCAACAATCTTTTAGCTGGTATGCACAACCACAACAACTCATACAGCGCACGTACACCTTTACAGCAGGCGG
GGGCTTCGGCACGACGAGGCGAGATTCGAAATGAGGCGTGGGATGTGCGAGCGAGCGAGCTTTCGCGCCTTAAAGCCCTCTAAGATCGCGCGCGCAACTT
CAATTCAAACGAAATCTCTAAATGAGGGAGCTGTTTGGACCCATACGTTTATTAAAATATTTTTTAATCGAGTTGCCAAATAAGGGGATGATTAAAAGGA
CGACCAAACCCATTTTCGAATTGTTTGAACGGAGACTTTTTTGATCCTCCAAACAATTCTGTTTAATCGCTCCGTTTAATGACCGGTTTAATCCCCCCTA
CACCTAATGACCAAACCGTTTTATATAGGTTTTGGAAGGCGCCCATTTGCGGCAGAATATGGGCGTTTTTGGCGGGTGAAATGGTGGGGTATGAAGTATG
AGATCTAAATTACGGAGCCTTCCAAGCCACAGCTAGGGGAAAATGAAAGCGAACTAGCGAGGGATAGGGTTCACTTAGTTTGTATCGCTCAAAACAGGAA
CTAAACAATAGTGGTTCCCACGGAGCGGTGAATAATCTATATTGTACTGTACACCGTGAGTGCCATCAGTTTAAAATAAAATACTCGAAGGAATCAAGTT
TTTTCGACCACATTCATTTTGTAATAGGATGCCAGCTACCTAAACGCTACCTCGGATACCAAGAAAAAGAATTCATGGGCTTGACGTGGGAATCGCAGCA
TTAATTATGAGCCAGCTTGACTTACATAAATAAAGATGCCATAATCGGCGTCCCTGCCAGCAGCAACCCCTCGTTCCTCCTGAATGAATGAATGAATGGT
TCGATTACCGATTTAATGTCCTTCTCGATTTGGACAGATACTATGCACTGGTACTAGTCGTACTAGATAATGAAAATAAAACTAATCCAACACTGTGCGA
AACACCACGCCGGTGCAGTACTCCTCGTTCCTCCAAGGCACCAACTGCGAAGCTGGGTACGAGAGCTGTCCTTCTCGAACGCGGTATTTTCCAGCACCCA
CGGTGGCAATTCGCGGTACCCCTCATCCGTGCTGATGTAGCCATTTTACGGCTTCGAGAAACAACTTTCTGATCTGACTCCGCTGCAATATTCTGGTACT
TTTTCAAGTAGCGAAAAAGTGTTTTTCCGCTGAACGGCCAAGACTTTGTGCGTCATGACCAAGTCTCGACGATACGACGCGCTTCGTTGCCGCGTGGCAG
CATCGGCCCCATTCTCGCCGCTCGTCGGGCCAATCAAGTGTGTGTGTGTGTGTGTGTATGTGCCCCGGTTTCCCGCTTAGATACGGCCCTGCAGAATGGA
GTGTCCGGCTGGGCGGGTTTTCCCAGCGCTAGGTAGGATTAGATTGTTGGCAATCCTCTCATTTGTGGTCTTACCTCGCCTCGGACAAGCAGCGCCCAAG
ACCAACACCGAGCGCGGCCCAGCATGAGTCGCTGCCACTGCGCGCTCGCAAAACCCACCACACGCTGCCTCAGCTCAGCTCTCCCGAGCCTTCTCTAATA
ATGAACGGATTGTGTATCTGATTGGTAGAAAGGTAATAAGCCAATAGGAGGTCAGTGTAGGTACGACTCACCGTAGGTATAGTGAAACCAAGTTAAAATA
GATATGCAGATGTAGGGCGGCTGTGGAGGCTTCGCGAAGCTTCCATCCGCCTGAACTGCGGGGGCGGCACTCTTAGGTCCGCACGCCCTCCCCCAAGACA
GCACTTCTTCCTGTTAAACTGGTAGCACTTGTTGGTCCCAGCAACCTGACTACAAGAAGCCCATGCCGACGAACGCCCAGCTACGAGCCGAGATCGACCG
GCTGAATCAAGCGATGGCAGAGCGCACGCGAGTGCCCACCAATCTGCCCAAGTTCACCGGCAAGCGGGGGGAAGACGTTCGCGAAGGGCTGTTCCGGATC
GAGAAGGCCTGTCGCATCAACGGAATCCAAATCGAAGACGCGAGCGCGCGTCTGCCGGGTATCGCCGGGTCGGCGATGGAAAAGCCGGCCTCAGGATGGT
TCCTGCACTGGTCATCGACGACGAGAAGTAAGGAGCACACGTGGGGGATTTTCCGTGAGCATGTGCTCCAACACTTCGAAGCTTCGAACTACCAGGCCGT
CTTGCGAGAAAAGCAGCAGCGACTCAAGCAAACGGCGGACATCGAGACCTCCAACGGCGAGTACTCTGCTCTTATCTCCCGAGTTGAGGGCATGAGTGTA
CTTGACCAGGTACTAAGCTACGCAAACGGTCTCAAGCCTCGTACCCGTAGCTACGTCAAGCTCGAGAACCCAGAGACGCTGAGCGCGGCTATGGATCTGG
CGATCAAGTACGAAGTTACGCACTTTGTGGACGACGTGCGCGACCGCCAGTCCCGCCAAGACAAGACGAAGATCTTCGCTGATCAAGCTCCCAAGCAAGA
CAAGCCATTCAAAGGGAAACCTTTCCGCGGCAAGGGACGGTTCAAGCCGAGGTCTGACTCCAAGCGTACTGAAGGCCGCACCTGCTATCACTGCAAGAAG
CCTGACCACATCAAGGCCAACTGCTTCCTCTGGAAGAAGGAGCAAGAGAAGCAGGGAAACGAGCAACCACGTCGGTGAATGAGGGTTCTGGCGTGGGCGA
GAGCGTAACCGGGACACCAAAGATTGAGAATATCAGCTTGAACGTTCTGTGCGAAAACCCTCTGGTCTACAAGTCACGTCCACTGTTCTCCGTAACAGGT
GAAATCAGTGTTGGTGACAAGTGTCTCGCGACACGAAGCATGTTGTTGGACTGTGGAGCTACCACGATCTACGTATCCGAGCGTTGGGTCGAGGAGCACC
AGCTTCAGACAACCAAGTTCAGCGACAAGAACATTCGTGTCAAGCTGGGAGACAACCAAATTGTCGAGGCGGAGCTTGAAGTTCTGCTGATAGAGATTCT
GGTCTCGAGGCTGGACGACGCCTACAAGTGTGTGGCAGTCGTCTACCCGATTCCAGGCGAATTCGATTGCATTCTTGGAATACCATTCTTCGAAGACGTG
CAACCACATATTGACTACGAATCGAAGGAACGAGAACGAGGACTCTGCACTGGAAGCGAACAGGGAAGACCTGTGAGCCGATCGAGGAAGGCGGACCGGT
GATTACCTCCGGGCTTCGGAGATCTGTCGAGGCGAAAGGCCTGTCGGCGAAAAGACCCGATTCCTGTCGAGGTGCCGCGCTGGAAACGGATGTGAAGCTC
ACGGTTGAAGCTGTTGGTGACGCAGTACAGAAGAAATCCCCAAGTGTTGTCCGCGGACGACATGATAACGCGCAAGCTGGCAAGAGTTCAGCTGGAGACG
ACGACGTTGCGACGTCTGAGCGCGAGAGTACTGTAGTCGAGGCTGATGGAAGCAGCAGTACCAGGGGTGGAGACAACGCCGTGGAGAAGATGTTCACGAT
GGGAGTTGTCGACGAGAGTGGTATACAGACCAAATACATCACGCGCAAGAAGTTGCGGAAGTTCCTGAGAATCAAGACCAAGACGAGCGACGAGCCTGAC
TTCATGTTGGTGCTATCGAACGAGACGATCAAGCAAGTTGCACGTTCACTGCAACGCCGAGATCAGCCCGACAACGTTGGGAGAGCGAAAGCACAACGCT
ATCTGGAGACAGACTGGGACACCTTCCGAGAGAATCCAGCTTTCAATCTTCTCATGGAGTATAAGGACAACGTGTTTCGTCCAGAACTACCCGAAGGTTT
ACCAGAGAAGCGTGACATTGAACACCGGATCGATGTGAAGGATCCAAATATGGCGATGTACAGGCAGCAGTGGCGACAGTCGCCGGAGCAGCAGCGTGAA
ATCGTGCGCTGGGTCGAAGACATGGTGAAGAAGAAGCTCATTCGACCAAGCATCAGTCCCCACGCAGCCCCAACATTCTGTGTCCGGAAACCAGTTGGCT
GGAGAATTGTTCACGACTACCGGTACTTGAATTCGAACACCGTGCGTCAAAGTATCCCGATGACGAGGAAGGAAGACATCCTTGACACCATGTCCGGTGC
GTACTGGTTCTCCACGATGGACCTGATGTCCGCGTACTACCAAGTGCGCATGCGGGAAGAAGACATCAAGTTTACCGCATTCCAAGCGCCGAACGGTCTC
TGGGAGTATCTCGTTCTTCCAATGGGAGTTTGCAACGCGCCAGCAACGATGCACAGATTGACATCGAAGCTCTTTCGAGACTTGAAGAACACGAAGTCGT
TCTACGATGACATCTATGTTTTCACCAAGTCACCGAAGATTGAGGACCATCTGGACGCACTGCGGAAAACACTTGACATCTTGCGTGATAACAAGTTGTA
CGTCAAGCTGTCCAA