Description :
From Genome Similarity Track
Location :
Scaffold_370:3714- 4764
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20242hypothetical protein

Sequence
1050 bases(100 bases per row)
TTCTCCATAGTAAATTCTACATACATGCGCACAAGCTTTTCAGACGCTGAAGACAAACTCCTGGTTCAGGTCGCTTTTCAGTTCGAGAGAGAGGGCCTTC
GTATCACCTGGGAGTATGTGGCCCGGCGGATGAAGATCACGCGCGCTGCACGACAGCTTCGCCTCCGGCTTGCCAGCCTAAAGCGAACTTATGGAAAGTC
GTTACGCAACTTCCCACCTTGTTGTTTTAGTGGGGCAACTTTGCAACGCCTTCTTCGCGCGCCTGGGCTCCCCCTTCCACCATTCTGTGATTTGCAGAGG
CCAGAAGATGGCGGAGGTGCGATAGGACAGCGCGGACAGCATGCCAGGGAAAAGTGAGGGAGGCCGGACAGCCCCACGAGTTCCAAGAGCAGCAGGTACG
CTGTAGACAACAGCACTTGTTACTGCGGTGCAGGTGCTAACGTTTACTTTGATCGTGCAGCAGGCGCAGATAACTGTTGTTCCCGAGAAGCGCGCGAGGG
GTGTATGTATAAGCCGCGGGGAGGACGGTTGAGTTCGAAGTTTGATGCAGCTGCAAAAAAAGCTCAGGTACGTCAAGCGGCTGAGTGTGGAAGCGAGATT
GAGTTGCTTACGTATGTCAATGCGTTGCAGCTTCGCACATGGGTGCAGTGGCGGAAGCAGACGGCGTGCCTTGCCCCACCATACAAGATGATTCTCATGG
TGGAGTACGACGTTAAGGTGATGCTAGCGTTGATGGTAAAGGTGCTGCTGTACGCTTCCACATCTCGCCTACACTAAGCCAGGAACAAGCTGCCGAAGCA
GTTGATGCCATATTCAGCAGTATTAGCGCGTACGACGTCCGTCAGCAAGCCGGTCGTACATACGACAATGCAGGCGAGGTGCTTCCTTCAGGCGTCGCCT
TGCTACTTGCGACAGTAGGACCTCTGGACGAAGAAGATGTTTTTCTGGACGTTGGAGCTGGAGTTGGCAACATCCTCGCCCAAGTCGCTCTTACAACGGA
CGCTCGACTTTGCGTTGGTATCGAATTTCGACGCGTCCTTGTCTCGCTCG