Description :
From Genome Similarity Track
Location :
Scaffold_227:37135- 41166
Transcript NameFunction/comments
Phypl_g5620hypothetical protein
Phypl_g5621conserved hypothetical protein
Phypl_g5622oligopeptidase A, putative

Sequence
4031 bases(100 bases per row)
ACACGCCCATCAGCCCGGACTTGATCAAGATCCTGTTCGAGCGCGTGTGGTTTTCCCTGCTCACTCTGTCGACGACGATATTGTGCGACAGCCAGTCGGA
CTTGTCCACGAGAATGCAGTGCCTCGACTTGCTGCGattctccatctccacgtGCTTGTTCTTGAATATGCCCGTCGAGCGGCAGGCATTTTGCAGTTTG
CTCCGGAAGGTTCAAGACTCGTTGGATGGGTCTGTCCACGATAGCGCCGAGGACGACCCAGCCGAGAATGGGCGCAAAGCCATTCCTGAAGACACCAAGT
ACGAGTGGGCGAGAACCatcgaagacgccgctgctaGCGACGATCCATGGAAGGCCATGGGTGACATTCATCTTCTCGTGAACGACATGAAGGAGACGAT
TCAAGTCCGCCAGAAgtcggagaagctggacTCGGTCCTTCAACGCATTCACCGAGCTCATTTCTACCTCAAGAACGCCACCACTTTTATCCACGAGGGC
GACCTCACGAAGAAGTGCAGGTCGCGCAATCAGCTTTaccgcttcttcctcttcaacGATCAATTGTTGTACGCTGACAAGAGCATGACCGGAAGGTGGA
GTCCGCACAACTCGCTGCGGCTTAAGCTCACGCGCATCTCCAACATCTCGGACGGTGTCATGTCCAAGCACGCTTTCCAGATTCAAAACCCGGTCAAGTC
CTTCGTCGTGTTCGCTGACAGTGCGAGCTCCAAGGCTGAGTGGATGCGTCTCATTGAAGACGCCATCGCAGAGGCATCCAAGAAGATCAACCGGACAGCA
CGGCGCATTTCGACCCAAGGTTTGGGCGAGACTCGATCTTCCGCGTCCTCGGCAATGAAAGTTTTCATGCGCTTCAGCTCCCCCATGACATCCCCGACAG
ACCGAGAAGACAGCCAGACCAGTCTCGACAGCGAAGGCGAATCGCCCGTGAAGACTGCGGAGGTCGGAGGATCGTCCAACGCGCAAAACACAGTGGCAAA
TGTTGCAGTTGATCAGAGCAACACCGACGAGTCAAGCGCAGCCGAAGACGGGCTGAAAGCTGCAAGCAGCGAAGACCACAAGGGCATTGTCACCGTCGAG
AAGGATCCCGAAGACGCTCCTCCGAGGTCTTCGGCGACAAGTAGCGAGGCAACGCTGCATGAAGCGACAGACTAAATTTCGACACACAGAGCTAAGATGA
ATTAGGTACGGAAGTTGGCACAGAGGAACATCAATCAATCACGAGATACTTAGACACTTTTCTCGGGTCAGTTTTCGTGTGTGCGTGGCTCTGAATCTGC
CACCGATGCACGCGGCTACCTGAGCTAACCGCGAGAGGAATAAATGGAATACATGGACGCATGCAGGGAAGAAAATGACGAAAGCGGCCGACTGACGGCG
GCACGGGGACCGACGGGGGGTGGTTGAACTCCTCTGTGCAAGCCCTCAGCTCAATCCTGTTGGATCAAGCTAAGGACTTGCACAGAAACCCTCGATGTCA
AAGAGGAACGGCGCCGCGCCGGCGTTGATCACGGCTTCGTCGCCAAATGCGTGAAGCgacactgcagcagcgtagTCACCGGGCAGCACCGTCACGGGCG
CCACTCCGACCAACTCGCCGTTGAGGGTGAAGAAGATCTGGtgctcgtcggcgtccagacCGCAGCCAACCGTGAACGTGggggcgtcctcctcctggtt
TTCGGACTGAGTCGTAGCTCGGCCCCACGACGGGCCGAAGGCGCCCCACTCGCCACCGTACGGCTTTGCGCCATCGTTGAACACGAAGTCGCCGTCATTG
CCGTGGTAGGCGTAGGACACGCCCTTCCAGCCCACGTGCTCTCCCGAGCCGAAGCCGTAAGCGTTCCGGGTCGCCGCGTCGGAGACGGACGCGAGACCCA
CGCTTCCGCAGCCTTTGAGGCCCACCTCGTAGTATGATACGTTCTTGAGCAgggcgcgcgcgcaggaGAGCACgggcagcttcttggcgccgcgGATTGA
GTCCACGGCGCCcttgtccaagctgcgcagcaTCGAGTTGTTCGCCACGCGGTACTTGCCGTCGGGCAAGTGGGTCACCGCGCTGCGCGTCGACAGCTCA
tagtcggtgtctgggcggcgcgcggcgcaCAGCGTGAGCTGGTCGCTGTAGGGCAGCGTCACATACGCCTCCGGCAGCATGTTGGCGCGCCACTGGCGGC
TGTACAGGCCCGCGAGCAGCATCTCCGAGgacgcgacgacgtcgtggaaGGCCGTACAGACCTGTGtggcgtcctgcagctcctccatcgtgaGGAACTC
GAAGCAGAGCTCGAGGGCGGCGAGTTCCAgcgcctcgccgtcgcgcgtGTGGCGACGTTTgaggcgcagcgccgtcagcagGTCCGCGACCTCGGCCGCG
ttctgcgagcgctgcaggTCGCTCCAGCGGACGTTGGCGTGCGACTGGCTGTGGCGCttggccacggcggcgtaCGACTCGTAGAGGACGCAGCagtcct
cgagctcgaggtcggagacgtccagctcgtcgtcgctgctgttgctggccgtggagcacgagctgctggcgatgctgccgcggcgacgcgcgaggcggcg
gctcgacgacttcttggtcagcaccacgaacgagTTGAGGTGCGGCAGGCGCGAAGACATGGCGGGCACAgtgggcgacggcagcgaagacagcagcgag
gtCAGCATGctggcgttgaagttgcGTGAGAGGATGGGGGAATGATGCAGCCGCTTGGCTTGGCTTGTGTGCGGTGGGTGGTCAACGCGGAGCCTTTCAG
TACTCTGGTTCTTGGTGATATTGCGCGGGCTACAGATCGCTTCGCGCTCAGGGTTCTGTTTGGATAATGAGTGATGTCTTCCGAAAGTTTGATTGCTGCA
AGCACGCGTATTCGGACGCCCTGCGAAAATCGATACCGCGTGGTCTCTTCAACATAGGTACTTGTCGAAATGGGCATCGCCGCATGGATACGCCGTGCGA
CCGCCGGTCTGTCTGCCAAGGAGCCCATTTTCGGAAAGCGACAGCAGGGTTGTCGTGGAGCACTACTCGTGGTTGCCACAACGCTGCTTCCTCAGAGAAA
GTGGTGCGTACGAGTAGTTATCTACATATTCCCATCGGTAAAGCAATAATTGCGGCACCAACTCGGTTGCCACCCGCAGGCTGCTGGAATTGCGTACTAA
GGCTGCTGGAATTCTACCGGCAGTCACAACTCGATGCTATGCACGTCGCCGAAATTCGGCGGCCGAATTACGTCTTAATGTAAGCATCTCACCCAACGGC
GGCGATCCTGGTCGGATATGGTCCACGATGAACTTGACAGCCGGCTCGATGTTGTTATGATAGAATAGCAAGGGCATCGGGCTTCCGTCCTGAGCTTGGT
TGAATCGGTGACGAACATCATCCACCGAAAGATAGATTCACGTTCTCGTAAGCGCTGCAGAAAACGCTTACACACGTGTATATTTTGCGCTTGGGTTTGC
TGCGCTGCACCAAGTAAGCATGTCGACATTAATCGACACGTGAGACCGACGGAGTGCAGTCTCGCCAAGCAGACGGATCGAAAATGGGTCGCTCTATCGC
AAATTGCGCAAGCTGCATGGTTTTGTACCCATTTCGCCTGCGGCGTCTATGCGCGAAAAATCCTGCGAAAACTTATACCGTGgagttgaagttgtagcTT
CTGAGCCCGTCGGGGCACTTTTCGGGACCATCGTGACCAACAACCGCGCACGGGCGACAATCGACTCGGGTTTTGCCTGTGAAACTTCCTACGCCGCGCT
CGCAAAGCGTTTAACgccgcagccgtcgctggcCACATAAAGTGCCGCCTCGCGAGGCAGCGGTTCTTTTCGGTGCTCGGTGTATGCATGACGGATACGT
GTTGAACTTGTCGGTAGACCAATTACGCCAGGCTTATCTACTTGTCGGCGAGTCCGTATTGcatgagcagcggcaccacggACGGCTTGCGCCCGCGGAA
GGCCTCGAACACCTGTTCCGggtgctggccg